diff options
| author | Fabian Mastenbroek <mail.fabianm@gmail.com> | 2021-10-25 14:53:54 +0200 |
|---|---|---|
| committer | Fabian Mastenbroek <mail.fabianm@gmail.com> | 2021-10-25 14:53:54 +0200 |
| commit | aa9b32f8cd1467e9718959f400f6777e5d71737d (patch) | |
| tree | b88bbede15108c6855d7f94ded4c7054df186a72 /opendc-trace/opendc-trace-wfformat/src/test | |
| parent | eb0e0a3bc557c05a70eead388797ab850ea87366 (diff) | |
| parent | b7a71e5b4aa77b41ef41deec2ace42b67a5a13a7 (diff) | |
merge: Integrate v2.1 progress into public repository
This pull request integrates the changes planned for the v2.1 release of
OpenDC into the public Github repository in order to sync the progress
of both repositories.
Diffstat (limited to 'opendc-trace/opendc-trace-wfformat/src/test')
3 files changed, 1788 insertions, 0 deletions
diff --git a/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt new file mode 100644 index 00000000..b07f27ed --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt @@ -0,0 +1,345 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wfformat + +import com.fasterxml.jackson.core.JsonFactory +import com.fasterxml.jackson.core.JsonParseException +import org.junit.jupiter.api.Assertions.* +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertDoesNotThrow +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TASK_ID +import org.opendc.trace.TASK_PARENTS + +/** + * Test suite for the [WfFormatTaskTableReader] class. + */ +internal class WfFormatTaskTableReaderTest { + /** + * The [JsonFactory] used to construct the parser. + */ + private val factory = JsonFactory() + + @Test + fun testEmptyInput() { + val content = "" + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertFalse(reader.nextRow()) + reader.close() + } + + @Test + fun testTopLevelArrayInput() { + val content = "[]" + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testNoWorkflow() { + val content = """ + { + "name": "eager-nextflow-chameleon" + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testWorkflowArrayType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": [] + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testWorkflowNullType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": null + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testNoJobs() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsObjectType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { "jobs": {} } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsNullType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { "jobs": null } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsInvalidChildType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [1] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsValidChildType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test" + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertEquals("test", reader.get(TASK_ID)) + assertFalse(reader.nextRow()) + + reader.close() + } + + @Test + fun testJobsInvalidParents() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": 1, + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsInvalidParentsItem() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": [1], + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsValidParents() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertEquals(setOf("1"), reader.get(TASK_PARENTS)) + assertFalse(reader.nextRow()) + + reader.close() + } + + @Test + fun testJobsInvalidSecondEntry() { + val content = """ + { + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + }, + "test" + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { reader.nextRow() } + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testDuplicateJobsArray() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + } + ], + "jobs": [ + { + "name": "test2", + "parents": ["test"] + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertTrue(reader.nextRow()) + assertEquals("test2", reader.get(TASK_ID)) + assertFalse(reader.nextRow()) + + reader.close() + } +} diff --git a/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt new file mode 100644 index 00000000..217b175d --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt @@ -0,0 +1,101 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wfformat + +import org.junit.jupiter.api.Assertions +import org.junit.jupiter.api.Assertions.* +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertDoesNotThrow +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.* +import java.nio.file.Paths + +/** + * Test suite for the [WfFormatTraceFormat] class. + */ +class WfFormatTraceFormatTest { + private val format = WfFormatTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/trace.json") + + assertEquals(listOf(TABLE_TASKS), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/trace.json") + Assertions.assertDoesNotThrow { format.getDetails(path, TABLE_TASKS) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/trace.json") + + assertThrows<IllegalArgumentException> { format.getDetails(path, "test") } + } + + /** + * Smoke test for parsing WfCommons traces. + */ + @Test + fun testTableReader() { + val path = Paths.get("src/test/resources/trace.json") + val reader = format.newReader(path, TABLE_TASKS) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("makebwaindex_mammoth_mt_krause.fasta", reader.get(TASK_ID)) }, + { assertEquals("eager-nextflow-chameleon", reader.get(TASK_WORKFLOW_ID)) }, + { assertEquals(172000, reader.get(TASK_RUNTIME).toMillis()) }, + { assertEquals(emptySet<String>(), reader.get(TASK_PARENTS)) }, + ) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("makeseqdict_mammoth_mt_krause.fasta", reader.get(TASK_ID)) }, + { assertEquals("eager-nextflow-chameleon", reader.get(TASK_WORKFLOW_ID)) }, + { assertEquals(175000, reader.get(TASK_RUNTIME).toMillis()) }, + { assertEquals(setOf("makebwaindex_mammoth_mt_krause.fasta"), reader.get(TASK_PARENTS)) }, + ) + + reader.close() + } + + /** + * Test full iteration of the table. + */ + @Test + fun testTableReaderFull() { + val path = Paths.get("src/test/resources/trace.json") + val reader = format.newReader(path, TABLE_TASKS) + + assertDoesNotThrow { + while (reader.nextRow()) { + // reader.get(TASK_ID) + } + reader.close() + } + } +} diff --git a/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json b/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json new file mode 100644 index 00000000..d21f024d --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json @@ -0,0 +1,1342 @@ +{ + "name": "eager-nextflow-chameleon", + "description": "Instance generated with WfCommons - https://wfcommons.org", + "createdAt": "2021-09-06T03:43:31.762479", + "schemaVersion": "1.2", + "author": { + "name": "cc", + "email": "support@wfcommons.org" + }, + "wms": { + "name": "Nextflow", + "version": "21.04.3", + "url": "https://www.nextflow.io" + }, + "workflow": { + "executedAt": "20210906T034331+0000", + "makespan": 275, + "jobs": [ + { + "name": "makebwaindex_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 172.182, + "command": { + "program": "makebwaindex", + "arguments": [ + "bwa", + "index", + "Mammoth_MT_Krause.fasta", + "mkdir", + "BWAIndex", + "&&", + "mv", + "Mammoth_MT_Krause.fasta*", + "BWAIndex" + ] + }, + "parents": [], + "children": [ + "makeseqdict_mammoth_mt_krause.fasta" + ], + "files": [], + "cores": 1.0, + "id": "ID000001", + "category": "makebwaindex", + "avgCPU": 5.8, + "bytesRead": 124, + "bytesWritten": 126, + "memory": 4248 + }, + { + "name": "makeseqdict_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 175.427, + "command": { + "program": "makeseqdict", + "arguments": [ + "picard", + "-Xmx6144M", + "CreateSequenceDictionary", + "R=Mammoth_MT_Krause.fasta", + "O=\"Mammoth_MT_Krause.dict\"" + ] + }, + "parents": [ + "makebwaindex_mammoth_mt_krause.fasta" + ], + "children": [ + "makefastaindex_mammoth_mt_krause.fasta" + ], + "files": [], + "cores": 1.0, + "id": "ID000003", + "category": "makeseqdict", + "avgCPU": 83.5, + "bytesRead": 22728, + "bytesWritten": 1300, + "memory": 104416 + }, + { + "name": "makefastaindex_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 170.797, + "command": { + "program": "makefastaindex", + "arguments": [ + "samtools", + "faidx", + "Mammoth_MT_Krause.fasta" + ] + }, + "parents": [ + "makeseqdict_mammoth_mt_krause.fasta" + ], + "children": [ + "output_documentation" + ], + "files": [], + "cores": 1.0, + "id": "ID000002", + "category": "makefastaindex", + "avgCPU": 23.8, + "bytesRead": 66, + "bytesWritten": 4, + "memory": 6096 + }, + { + "name": "output_documentation", + "type": "compute", + "runtime": 173.479, + "command": { + "program": "output_documentation", + "arguments": [ + "markdown_to_html.py", + "output.md", + "-o", + "results_description.html" + ] + }, + "parents": [ + "makefastaindex_mammoth_mt_krause.fasta" + ], + "children": [ + "get_software_versions" + ], + "files": [], + "cores": 1.0, + "id": "ID000005", + "category": "output_documentation", + "avgCPU": 84.0, + "bytesRead": 8222, + "bytesWritten": 15165, + "memory": 11488 + }, + { + "name": "get_software_versions", + "type": "compute", + "runtime": 183.445, + "command": { + "program": "get_software_versions", + "arguments": [ + "echo", + "2.3.5", + "&>", + "v_pipeline.txt", + "echo", + "21.04.3", + "&>", + "v_nextflow.txt", + "fastqc", + "--version", + "&>", + "v_fastqc.txt", + "2>&1", + "||", + "true", + "AdapterRemoval", + "--version", + "&>", + "v_adapterremoval.txt", + "2>&1", + "||", + "true", + "fastp", + "--version", + "&>", + "v_fastp.txt", + "2>&1", + "||", + "true", + "bwa", + "&>", + "v_bwa.txt", + "2>&1", + "||", + "true", + "circulargenerator", + "--help", + "|", + "head", + "-n", + "1", + "&>", + "v_circulargenerator.txt", + "2>&1", + "||", + "true", + "samtools", + "--version", + "&>", + "v_samtools.txt", + "2>&1", + "||", + "true", + "dedup", + "-v", + "&>", + "v_dedup.txt", + "2>&1", + "||", + "true", + "##", + "bioconda", + "recipe", + "of", + "picard", + "is", + "incorrectly", + "set", + "up", + "and", + "extra", + "warning", + "made", + "with", + "stderr,", + "this", + "ugly", + "command", + "ensures", + "only", + "version", + "exported", + "(", + "exec", + "7>&1", + "picard", + "MarkDuplicates", + "--version", + "2>&1", + ">&7", + "|", + "grep", + "-v", + "/", + ">&2", + ")", + "2>", + "v_markduplicates.txt", + "||", + "true", + "qualimap", + "--version", + "&>", + "v_qualimap.txt", + "2>&1", + "||", + "true", + "preseq", + "&>", + "v_preseq.txt", + "2>&1", + "||", + "true", + "gatk", + "--version", + "2>&1", + "|", + "head", + "-n", + "1", + ">", + "v_gatk.txt", + "2>&1", + "||", + "true", + "gatk3", + "--version", + "2>&1", + ">", + "v_gatk3.txt", + "2>&1", + "||", + "true", + "freebayes", + "--version", + "&>", + "v_freebayes.txt", + "2>&1", + "||", + "true", + "bedtools", + "--version", + "&>", + "v_bedtools.txt", + "2>&1", + "||", + "true", + "damageprofiler", + "--version", + "&>", + "v_damageprofiler.txt", + "2>&1", + "||", + "true", + "bam", + "--version", + "&>", + "v_bamutil.txt", + "2>&1", + "||", + "true", + "pmdtools", + "--version", + "&>", + "v_pmdtools.txt", + "2>&1", + "||", + "true", + "angsd", + "-h", + "|&", + "head", + "-n", + "1", + "|", + "cut", + "-d", + "-f3-4", + "&>", + "v_angsd.txt", + "2>&1", + "||", + "true", + "multivcfanalyzer", + "--help", + "|", + "head", + "-n", + "1", + "&>", + "v_multivcfanalyzer.txt", + "2>&1", + "||", + "true", + "malt-run", + "--help", + "|&", + "tail", + "-n", + "3", + "|", + "head", + "-n", + "1", + "|", + "cut", + "-f", + "2", + "-d(", + "|", + "cut", + "-f", + "1", + "-d", + ",", + "&>", + "v_malt.txt", + "2>&1", + "||", + "true", + "MaltExtract", + "--help", + "|", + "head", + "-n", + "2", + "|", + "tail", + "-n", + "1", + "&>", + "v_maltextract.txt", + "2>&1", + "||", + "true", + "multiqc", + "--version", + "&>", + "v_multiqc.txt", + "2>&1", + "||", + "true", + "vcf2genome", + "-h", + "|&", + "head", + "-n", + "1", + "&>", + "v_vcf2genome.txt", + "||", + "true", + "mtnucratio", + "--help", + "&>", + "v_mtnucratiocalculator.txt", + "||", + "true", + "sexdeterrmine", + "--version", + "&>", + "v_sexdeterrmine.txt", + "||", + "true", + "kraken2", + "--version", + "|", + "head", + "-n", + "1", + "&>", + "v_kraken.txt", + "||", + "true", + "endorS.py", + "--version", + "&>", + "v_endorSpy.txt", + "||", + "true", + "pileupCaller", + "--version", + "&>", + "v_sequencetools.txt", + "2>&1", + "||", + "true", + "bowtie2", + "--version", + "|", + "grep", + "-a", + "bowtie2-.*", + "-fdebug", + ">", + "v_bowtie2.txt", + "||", + "true", + "eigenstrat_snp_coverage", + "--version", + "|", + "cut", + "-d", + "-f2", + ">v_eigenstrat_snp_coverage.txt", + "||", + "true", + "mapDamage", + "--version", + ">", + "v_mapdamage.txt", + "||", + "true", + "bbduk.sh", + "|", + "grep", + "Last", + "modified", + "|", + "cut", + "-d", + "-f", + "3-99", + ">", + "v_bbduk.txt", + "||", + "true", + "scrape_software_versions.py", + "&>", + "software_versions_mqc.yaml" + ] + }, + "parents": [ + "output_documentation" + ], + "children": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000006", + "category": "get_software_versions", + "avgCPU": 147.8, + "bytesRead": 172760, + "bytesWritten": 1048, + "memory": 387324 + }, + { + "name": "fastqc_jk2782_l1", + "type": "compute", + "runtime": 175.205, + "command": { + "program": "fastqc", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz", + "rename", + "s/_fastqc.zip$/_raw_fastqc.zip/", + "*_fastqc.zip", + "rename", + "s/_fastqc.html$/_raw_fastqc.html/", + "*_fastqc.html" + ] + }, + "parents": [ + "get_software_versions" + ], + "children": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000007", + "category": "fastqc", + "avgCPU": 161.8, + "bytesRead": 35981, + "bytesWritten": 3967, + "memory": 270124 + }, + { + "name": "adapter_removal_jk2782_l1", + "type": "compute", + "runtime": 172.643, + "command": { + "program": "adapter_removal", + "arguments": [ + "mkdir", + "-p", + "output", + "AdapterRemoval", + "--file1", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "--file2", + "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz", + "--basename", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe", + "--gzip", + "--threads", + "2", + "--qualitymax", + "41", + "--collapse", + "--trimns", + "--trimqualities", + "--adapter1", + "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", + "--adapter2", + "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA", + "--minlength", + "30", + "--minquality", + "20", + "--minadapteroverlap", + "1", + "cat", + "*.collapsed.gz", + "*.collapsed.truncated.gz", + "*.singleton.truncated.gz", + "*.pair1.truncated.gz", + "*.pair2.truncated.gz", + ">", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz", + "mv", + "*.settings", + "output/", + "##", + "Add", + "R_", + "and", + "L_", + "for", + "unmerged", + "reads", + "for", + "DeDup", + "compatibility", + "AdapterRemovalFixPrefix", + "-Xmx4g", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz", + "|", + "pigz", + "-p", + "1", + ">", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz" + ] + }, + "parents": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "children": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000008", + "category": "adapter_removal", + "avgCPU": 160.9, + "bytesRead": 17357, + "bytesWritten": 4405, + "memory": 79308 + }, + { + "name": "fastqc_jk2802_l2", + "type": "compute", + "runtime": 177.338, + "command": { + "program": "fastqc", + "arguments": [ + "fastqc", + "-q", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "rename", + "s/_fastqc.zip$/_raw_fastqc.zip/", + "*_fastqc.zip", + "rename", + "s/_fastqc.html$/_raw_fastqc.html/", + "*_fastqc.html" + ] + }, + "parents": [ + "get_software_versions" + ], + "children": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000009", + "category": "fastqc", + "avgCPU": 120.1, + "bytesRead": 24457, + "bytesWritten": 2181, + "memory": 181060 + }, + { + "name": "adapter_removal_jk2802_l2", + "type": "compute", + "runtime": 174.313, + "command": { + "program": "adapter_removal", + "arguments": [ + "mkdir", + "-p", + "output", + "AdapterRemoval", + "--file1", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "--basename", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se", + "--gzip", + "--threads", + "2", + "--qualitymax", + "41", + "--trimns", + "--trimqualities", + "--adapter1", + "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", + "--adapter2", + "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA", + "--minlength", + "30", + "--minquality", + "20", + "--minadapteroverlap", + "1", + "mv", + "*.settings", + "*.se.truncated.gz", + "output/" + ] + }, + "parents": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "children": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000010", + "category": "adapter_removal", + "avgCPU": 106.5, + "bytesRead": 683, + "bytesWritten": 897, + "memory": 12136 + }, + { + "name": "fastqc_after_clipping_jk2782_l1", + "type": "compute", + "runtime": 15.371, + "command": { + "program": "fastqc_after_clipping", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz" + ] + }, + "parents": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "children": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "files": [], + "cores": 2.0, + "id": "ID000013", + "category": "fastqc_after_clipping", + "avgCPU": 133.3, + "bytesRead": 23788, + "bytesWritten": 1998, + "memory": 215020 + }, + { + "name": "fastqc_after_clipping_jk2802_l2", + "type": "compute", + "runtime": 15.272, + "command": { + "program": "fastqc_after_clipping", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz" + ] + }, + "parents": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "children": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "files": [], + "cores": 2.0, + "id": "ID000014", + "category": "fastqc_after_clipping", + "avgCPU": 124.1, + "bytesRead": 23882, + "bytesWritten": 2143, + "memory": 213064 + }, + { + "name": "bwa_jk2802", + "type": "compute", + "runtime": 9.566, + "command": { + "program": "bwa", + "arguments": [ + "bwa", + "aln", + "-t", + "2", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz", + "-n", + "0.04", + "-l", + "1024", + "-k", + "2", + "-o", + "1", + "-f", + "JK2802.sai", + "bwa", + "samse", + "-r", + "\"@RGtID:ILLUMINA-JK2802tSM:JK2802tPL:illuminatPU:ILLUMINA-JK2802-SE\"", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2802.sai", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz", + "|", + "samtools", + "sort", + "-@", + "1", + "-O", + "bam", + "-", + ">", + "\"JK2802\"_\"SE\".mapped.bam", + "samtools", + "index", + "\"JK2802\"_\"SE\".mapped.bam" + ] + }, + "parents": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "children": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000016", + "category": "bwa", + "avgCPU": 15.7, + "bytesRead": 3774, + "bytesWritten": 3367, + "memory": 10628 + }, + { + "name": "bwa_jk2782", + "type": "compute", + "runtime": 9.652, + "command": { + "program": "bwa", + "arguments": [ + "bwa", + "aln", + "-t", + "2", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz", + "-n", + "0.04", + "-l", + "1024", + "-k", + "2", + "-o", + "1", + "-f", + "JK2782.sai", + "bwa", + "samse", + "-r", + "\"@RGtID:ILLUMINA-JK2782tSM:JK2782tPL:illuminatPU:ILLUMINA-JK2782-PE\"", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2782.sai", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz", + "|", + "samtools", + "sort", + "-@", + "1", + "-O", + "bam", + "-", + ">", + "\"JK2782\"_\"PE\".mapped.bam", + "samtools", + "index", + "\"JK2782\"_\"PE\".mapped.bam" + ] + }, + "parents": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "children": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000015", + "category": "bwa", + "avgCPU": 69.8, + "bytesRead": 3705, + "bytesWritten": 3355, + "memory": 12876 + }, + { + "name": "samtools_flagstat_jk2782", + "type": "compute", + "runtime": 13.011, + "command": { + "program": "samtools_flagstat", + "arguments": [ + "samtools", + "flagstat", + "JK2782_PE.mapped.bam", + ">", + "JK2782_flagstat.stats" + ] + }, + "parents": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "children": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000026", + "category": "samtools_flagstat", + "avgCPU": 30.1, + "bytesRead": 478, + "bytesWritten": 5, + "memory": 6468 + }, + { + "name": "samtools_flagstat_jk2802", + "type": "compute", + "runtime": 13.129, + "command": { + "program": "samtools_flagstat", + "arguments": [ + "samtools", + "flagstat", + "JK2802_SE.mapped.bam", + ">", + "JK2802_flagstat.stats" + ] + }, + "parents": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "children": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000024", + "category": "samtools_flagstat", + "avgCPU": 118.5, + "bytesRead": 551, + "bytesWritten": 5 + }, + { + "name": "markduplicates_jk2782", + "type": "compute", + "runtime": 22.655, + "command": { + "program": "markduplicates", + "arguments": [ + "mv", + "JK2782_PE.mapped.bam", + "JK2782.bam", + "picard", + "-Xmx4096M", + "MarkDuplicates", + "INPUT=JK2782.bam", + "OUTPUT=JK2782_rmdup.bam", + "REMOVE_DUPLICATES=TRUE", + "AS=TRUE", + "METRICS_FILE=\"JK2782_rmdup.metrics\"", + "VALIDATION_STRINGENCY=SILENT", + "samtools", + "index", + "JK2782_rmdup.bam" + ] + }, + "parents": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "children": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000021", + "category": "markduplicates", + "avgCPU": 173.6, + "bytesRead": 24055, + "bytesWritten": 2319, + "memory": 1400048 + }, + { + "name": "markduplicates_jk2802", + "type": "compute", + "runtime": 21.545, + "command": { + "program": "markduplicates", + "arguments": [ + "mv", + "JK2802_SE.mapped.bam", + "JK2802.bam", + "picard", + "-Xmx4096M", + "MarkDuplicates", + "INPUT=JK2802.bam", + "OUTPUT=JK2802_rmdup.bam", + "REMOVE_DUPLICATES=TRUE", + "AS=TRUE", + "METRICS_FILE=\"JK2802_rmdup.metrics\"", + "VALIDATION_STRINGENCY=SILENT", + "samtools", + "index", + "JK2802_rmdup.bam" + ] + }, + "parents": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "children": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000020", + "category": "markduplicates", + "avgCPU": 182.6, + "bytesRead": 24242, + "bytesWritten": 2466, + "memory": 1404624 + }, + { + "name": "preseq_jk2782", + "type": "compute", + "runtime": 12.299, + "command": { + "program": "preseq", + "arguments": [ + "preseq", + "c_curve", + "-s", + "1000", + "-o", + "JK2782_PE.mapped.ccurve", + "-B", + "JK2782_PE.mapped.bam" + ] + }, + "parents": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "children": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000030", + "category": "preseq", + "avgCPU": 81.9, + "bytesRead": 473, + "bytesWritten": 4, + "memory": 12032 + }, + { + "name": "preseq_jk2802", + "type": "compute", + "runtime": 10.188, + "command": { + "program": "preseq", + "arguments": [ + "preseq", + "c_curve", + "-s", + "1000", + "-o", + "JK2802_SE.mapped.ccurve", + "-B", + "JK2802_SE.mapped.bam" + ] + }, + "parents": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "children": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000027", + "category": "preseq", + "avgCPU": 77.6, + "bytesRead": 548, + "bytesWritten": 4, + "memory": 11972 + }, + { + "name": "endorspy_jk2782", + "type": "compute", + "runtime": 7.537, + "command": { + "program": "endorspy", + "arguments": [ + "endorS.py", + "-o", + "json", + "-n", + "JK2782", + "JK2782_flagstat.stats" + ] + }, + "parents": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "children": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000031", + "category": "endorspy", + "avgCPU": 44.7, + "bytesRead": 623, + "bytesWritten": 4, + "memory": 12264 + }, + { + "name": "endorspy_jk2802", + "type": "compute", + "runtime": 8.0, + "command": { + "program": "endorspy", + "arguments": [ + "endorS.py", + "-o", + "json", + "-n", + "JK2802", + "JK2802_flagstat.stats" + ] + }, + "parents": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "children": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000032", + "category": "endorspy", + "avgCPU": 54.0, + "bytesRead": 623, + "bytesWritten": 4, + "memory": 12224 + }, + { + "name": "damageprofiler_jk2802", + "type": "compute", + "runtime": 18.596, + "command": { + "program": "damageprofiler", + "arguments": [ + "damageprofiler", + "-Xmx4g", + "-i", + "JK2802_rmdup.bam", + "-r", + "Mammoth_MT_Krause.fasta", + "-l", + "100", + "-t", + "15", + "-o", + ".", + "-yaxis_damageplot", + "0.30" + ] + }, + "parents": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "children": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000033", + "category": "damageprofiler", + "avgCPU": 88.6, + "bytesRead": 25744, + "bytesWritten": 391, + "memory": 242940 + }, + { + "name": "damageprofiler_jk2782", + "type": "compute", + "runtime": 16.736, + "command": { + "program": "damageprofiler", + "arguments": [ + "damageprofiler", + "-Xmx4g", + "-i", + "JK2782_rmdup.bam", + "-r", + "Mammoth_MT_Krause.fasta", + "-l", + "100", + "-t", + "15", + "-o", + ".", + "-yaxis_damageplot", + "0.30" + ] + }, + "parents": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "children": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000036", + "category": "damageprofiler", + "avgCPU": 88.3, + "bytesRead": 25661, + "bytesWritten": 327, + "memory": 198276 + }, + { + "name": "qualimap_jk2802", + "type": "compute", + "runtime": 15.368, + "command": { + "program": "qualimap", + "arguments": [ + "qualimap", + "bamqc", + "-bam", + "JK2802_rmdup.bam", + "-nt", + "2", + "-outdir", + ".", + "-outformat", + "\"HTML\"", + "--java-mem-size=4G" + ] + }, + "parents": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "children": [ + "multiqc_1" + ], + "files": [], + "cores": 2.0, + "id": "ID000053", + "category": "qualimap", + "avgCPU": 177.7, + "bytesRead": 35038, + "bytesWritten": 1712, + "memory": 209440 + }, + { + "name": "qualimap_jk2782", + "type": "compute", + "runtime": 14.223, + "command": { + "program": "qualimap", + "arguments": [ + "qualimap", + "bamqc", + "-bam", + "JK2782_rmdup.bam", + "-nt", + "2", + "-outdir", + ".", + "-outformat", + "\"HTML\"", + "--java-mem-size=4G" + ] + }, + "parents": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "children": [ + "multiqc_1" + ], + "files": [], + "cores": 2.0, + "id": "ID000054", + "category": "qualimap", + "avgCPU": 181.9, + "bytesRead": 34954, + "bytesWritten": 1937, + "memory": 232196 + }, + { + "name": "multiqc_1", + "type": "compute", + "runtime": 46.376, + "command": { + "program": "multiqc", + "arguments": [ + "multiqc", + "-f", + "multiqc_config.yaml", + "." + ] + }, + "parents": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "children": [], + "files": [], + "cores": 1.0, + "id": "ID000056", + "category": "multiqc", + "avgCPU": 93.0, + "bytesRead": 1215169, + "bytesWritten": 22599, + "memory": 139496 + } + ] + } +} |
