diff options
| author | Fabian Mastenbroek <mail.fabianm@gmail.com> | 2021-10-25 14:53:54 +0200 |
|---|---|---|
| committer | Fabian Mastenbroek <mail.fabianm@gmail.com> | 2021-10-25 14:53:54 +0200 |
| commit | aa9b32f8cd1467e9718959f400f6777e5d71737d (patch) | |
| tree | b88bbede15108c6855d7f94ded4c7054df186a72 /opendc-trace/opendc-trace-wfformat/src | |
| parent | eb0e0a3bc557c05a70eead388797ab850ea87366 (diff) | |
| parent | b7a71e5b4aa77b41ef41deec2ace42b67a5a13a7 (diff) | |
merge: Integrate v2.1 progress into public repository
This pull request integrates the changes planned for the v2.1 release of
OpenDC into the public Github repository in order to sync the progress
of both repositories.
Diffstat (limited to 'opendc-trace/opendc-trace-wfformat/src')
6 files changed, 2106 insertions, 0 deletions
diff --git a/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReader.kt b/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReader.kt new file mode 100644 index 00000000..7f378d80 --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReader.kt @@ -0,0 +1,242 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wfformat + +import com.fasterxml.jackson.core.JsonParseException +import com.fasterxml.jackson.core.JsonParser +import com.fasterxml.jackson.core.JsonToken +import org.opendc.trace.* +import java.time.Duration +import kotlin.math.roundToInt + +/** + * A [TableReader] implementation for the WfCommons workload trace format. + */ +internal class WfFormatTaskTableReader(private val parser: JsonParser) : TableReader { + /** + * The current nesting of the parser. + */ + private var level: ParserLevel = ParserLevel.TOP + + override fun nextRow(): Boolean { + reset() + + var hasJob = false + + while (!hasJob) { + when (level) { + ParserLevel.TOP -> { + val token = parser.nextToken() + + // Check whether the document is not empty and starts with an object + if (token == null) { + break + } else if (token != JsonToken.START_OBJECT) { + throw JsonParseException(parser, "Expected object", parser.currentLocation) + } else { + level = ParserLevel.TRACE + } + } + ParserLevel.TRACE -> { + // Seek for the workflow object in the file + if (!seekWorkflow()) { + break + } else if (!parser.isExpectedStartObjectToken) { + throw JsonParseException(parser, "Expected object", parser.currentLocation) + } else { + level = ParserLevel.WORKFLOW + } + } + ParserLevel.WORKFLOW -> { + // Seek for the jobs object in the file + level = if (!seekJobs()) { + ParserLevel.TRACE + } else if (!parser.isExpectedStartArrayToken) { + throw JsonParseException(parser, "Expected array", parser.currentLocation) + } else { + ParserLevel.JOB + } + } + ParserLevel.JOB -> { + when (parser.nextToken()) { + JsonToken.END_ARRAY -> level = ParserLevel.WORKFLOW + JsonToken.START_OBJECT -> { + parseJob() + hasJob = true + break + } + else -> throw JsonParseException(parser, "Unexpected token", parser.currentLocation) + } + } + } + } + + return hasJob + } + + override fun resolve(column: TableColumn<*>): Int = columns[column] ?: -1 + + override fun isNull(index: Int): Boolean { + check(index in 0..columns.size) { "Invalid column value" } + return false + } + + override fun get(index: Int): Any? { + return when (index) { + COL_ID -> id + COL_WORKFLOW_ID -> workflowId + COL_RUNTIME -> runtime + COL_PARENTS -> parents + COL_CHILDREN -> children + COL_NPROC -> getInt(index) + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + return when (index) { + COL_NPROC -> cores + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + parser.close() + } + + /** + * Parse the trace and seek until the workflow description. + */ + private fun seekWorkflow(): Boolean { + while (parser.nextValue() != JsonToken.END_OBJECT) { + when (parser.currentName) { + "name" -> workflowId = parser.text + "workflow" -> return true + else -> parser.skipChildren() + } + } + + return false + } + + /** + * Parse the workflow description in the file and seek until the first job. + */ + private fun seekJobs(): Boolean { + while (parser.nextValue() != JsonToken.END_OBJECT) { + when (parser.currentName) { + "jobs" -> return true + else -> parser.skipChildren() + } + } + + return false + } + + /** + * Parse a single job in the file. + */ + private fun parseJob() { + while (parser.nextValue() != JsonToken.END_OBJECT) { + when (parser.currentName) { + "name" -> id = parser.text + "parents" -> parents = parseIds() + "children" -> children = parseIds() + "runtime" -> runtime = Duration.ofSeconds(parser.numberValue.toLong()) + "cores" -> cores = parser.floatValue.roundToInt() + else -> parser.skipChildren() + } + } + } + + /** + * Parse the parents/children of a job. + */ + private fun parseIds(): Set<String> { + if (!parser.isExpectedStartArrayToken) { + throw JsonParseException(parser, "Expected array", parser.currentLocation) + } + + val ids = mutableSetOf<String>() + + while (parser.nextToken() != JsonToken.END_ARRAY) { + if (parser.currentToken != JsonToken.VALUE_STRING) { + throw JsonParseException(parser, "Expected token", parser.currentLocation) + } + + ids.add(parser.valueAsString) + } + + return ids + } + + private enum class ParserLevel { + TOP, TRACE, WORKFLOW, JOB + } + + /** + * State fields for the parser. + */ + private var id: String? = null + private var workflowId: String? = null + private var runtime: Duration? = null + private var parents: Set<String>? = null + private var children: Set<String>? = null + private var cores = -1 + + private fun reset() { + id = null + runtime = null + parents = null + children = null + cores = -1 + } + + private val COL_ID = 0 + private val COL_WORKFLOW_ID = 1 + private val COL_RUNTIME = 3 + private val COL_NPROC = 4 + private val COL_PARENTS = 5 + private val COL_CHILDREN = 6 + + private val columns = mapOf( + TASK_ID to COL_ID, + TASK_WORKFLOW_ID to COL_WORKFLOW_ID, + TASK_RUNTIME to COL_RUNTIME, + TASK_REQ_NCPUS to COL_NPROC, + TASK_PARENTS to COL_PARENTS, + TASK_CHILDREN to COL_CHILDREN, + ) +} diff --git a/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormat.kt b/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormat.kt new file mode 100644 index 00000000..c75e3cbb --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormat.kt @@ -0,0 +1,75 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wfformat + +import com.fasterxml.jackson.core.JsonFactory +import org.opendc.trace.* +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import java.nio.file.Path + +/** + * A [TraceFormat] implementation for the WfCommons workload trace format. + */ +public class WfFormatTraceFormat : TraceFormat { + /** + * The [JsonFactory] that is used to created JSON parsers. + */ + private val factory = JsonFactory() + + override val name: String = "wfformat" + + override fun create(path: Path) { + throw UnsupportedOperationException("Writing not supported for this format") + } + + override fun getTables(path: Path): List<String> = listOf(TABLE_TASKS) + + override fun getDetails(path: Path, table: String): TableDetails { + return when (table) { + TABLE_TASKS -> TableDetails( + listOf( + TASK_ID, + TASK_WORKFLOW_ID, + TASK_RUNTIME, + TASK_REQ_NCPUS, + TASK_PARENTS, + TASK_CHILDREN + ), + emptyList() + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader(path: Path, table: String): TableReader { + return when (table) { + TABLE_TASKS -> WfFormatTaskTableReader(factory.createParser(path.toFile())) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter(path: Path, table: String): TableWriter { + throw UnsupportedOperationException("Writing not supported for this format") + } +} diff --git a/opendc-trace/opendc-trace-wfformat/src/main/resources/META-INF/services/org.opendc.trace.spi.TraceFormat b/opendc-trace/opendc-trace-wfformat/src/main/resources/META-INF/services/org.opendc.trace.spi.TraceFormat new file mode 100644 index 00000000..ee3aa2f6 --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/main/resources/META-INF/services/org.opendc.trace.spi.TraceFormat @@ -0,0 +1 @@ +org.opendc.trace.wfformat.WfFormatTraceFormat diff --git a/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt new file mode 100644 index 00000000..b07f27ed --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt @@ -0,0 +1,345 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wfformat + +import com.fasterxml.jackson.core.JsonFactory +import com.fasterxml.jackson.core.JsonParseException +import org.junit.jupiter.api.Assertions.* +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertDoesNotThrow +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TASK_ID +import org.opendc.trace.TASK_PARENTS + +/** + * Test suite for the [WfFormatTaskTableReader] class. + */ +internal class WfFormatTaskTableReaderTest { + /** + * The [JsonFactory] used to construct the parser. + */ + private val factory = JsonFactory() + + @Test + fun testEmptyInput() { + val content = "" + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertFalse(reader.nextRow()) + reader.close() + } + + @Test + fun testTopLevelArrayInput() { + val content = "[]" + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testNoWorkflow() { + val content = """ + { + "name": "eager-nextflow-chameleon" + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testWorkflowArrayType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": [] + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testWorkflowNullType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": null + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testNoJobs() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsObjectType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { "jobs": {} } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsNullType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { "jobs": null } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsInvalidChildType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [1] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsValidChildType() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test" + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertEquals("test", reader.get(TASK_ID)) + assertFalse(reader.nextRow()) + + reader.close() + } + + @Test + fun testJobsInvalidParents() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": 1, + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsInvalidParentsItem() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": [1], + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsValidParents() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertEquals(setOf("1"), reader.get(TASK_PARENTS)) + assertFalse(reader.nextRow()) + + reader.close() + } + + @Test + fun testJobsInvalidSecondEntry() { + val content = """ + { + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + }, + "test" + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { reader.nextRow() } + assertThrows<JsonParseException> { reader.nextRow() } + + reader.close() + } + + @Test + fun testDuplicateJobsArray() { + val content = """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + } + ], + "jobs": [ + { + "name": "test2", + "parents": ["test"] + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertTrue(reader.nextRow()) + assertEquals("test2", reader.get(TASK_ID)) + assertFalse(reader.nextRow()) + + reader.close() + } +} diff --git a/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt new file mode 100644 index 00000000..217b175d --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt @@ -0,0 +1,101 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wfformat + +import org.junit.jupiter.api.Assertions +import org.junit.jupiter.api.Assertions.* +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertDoesNotThrow +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.* +import java.nio.file.Paths + +/** + * Test suite for the [WfFormatTraceFormat] class. + */ +class WfFormatTraceFormatTest { + private val format = WfFormatTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/trace.json") + + assertEquals(listOf(TABLE_TASKS), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/trace.json") + Assertions.assertDoesNotThrow { format.getDetails(path, TABLE_TASKS) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/trace.json") + + assertThrows<IllegalArgumentException> { format.getDetails(path, "test") } + } + + /** + * Smoke test for parsing WfCommons traces. + */ + @Test + fun testTableReader() { + val path = Paths.get("src/test/resources/trace.json") + val reader = format.newReader(path, TABLE_TASKS) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("makebwaindex_mammoth_mt_krause.fasta", reader.get(TASK_ID)) }, + { assertEquals("eager-nextflow-chameleon", reader.get(TASK_WORKFLOW_ID)) }, + { assertEquals(172000, reader.get(TASK_RUNTIME).toMillis()) }, + { assertEquals(emptySet<String>(), reader.get(TASK_PARENTS)) }, + ) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("makeseqdict_mammoth_mt_krause.fasta", reader.get(TASK_ID)) }, + { assertEquals("eager-nextflow-chameleon", reader.get(TASK_WORKFLOW_ID)) }, + { assertEquals(175000, reader.get(TASK_RUNTIME).toMillis()) }, + { assertEquals(setOf("makebwaindex_mammoth_mt_krause.fasta"), reader.get(TASK_PARENTS)) }, + ) + + reader.close() + } + + /** + * Test full iteration of the table. + */ + @Test + fun testTableReaderFull() { + val path = Paths.get("src/test/resources/trace.json") + val reader = format.newReader(path, TABLE_TASKS) + + assertDoesNotThrow { + while (reader.nextRow()) { + // reader.get(TASK_ID) + } + reader.close() + } + } +} diff --git a/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json b/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json new file mode 100644 index 00000000..d21f024d --- /dev/null +++ b/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json @@ -0,0 +1,1342 @@ +{ + "name": "eager-nextflow-chameleon", + "description": "Instance generated with WfCommons - https://wfcommons.org", + "createdAt": "2021-09-06T03:43:31.762479", + "schemaVersion": "1.2", + "author": { + "name": "cc", + "email": "support@wfcommons.org" + }, + "wms": { + "name": "Nextflow", + "version": "21.04.3", + "url": "https://www.nextflow.io" + }, + "workflow": { + "executedAt": "20210906T034331+0000", + "makespan": 275, + "jobs": [ + { + "name": "makebwaindex_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 172.182, + "command": { + "program": "makebwaindex", + "arguments": [ + "bwa", + "index", + "Mammoth_MT_Krause.fasta", + "mkdir", + "BWAIndex", + "&&", + "mv", + "Mammoth_MT_Krause.fasta*", + "BWAIndex" + ] + }, + "parents": [], + "children": [ + "makeseqdict_mammoth_mt_krause.fasta" + ], + "files": [], + "cores": 1.0, + "id": "ID000001", + "category": "makebwaindex", + "avgCPU": 5.8, + "bytesRead": 124, + "bytesWritten": 126, + "memory": 4248 + }, + { + "name": "makeseqdict_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 175.427, + "command": { + "program": "makeseqdict", + "arguments": [ + "picard", + "-Xmx6144M", + "CreateSequenceDictionary", + "R=Mammoth_MT_Krause.fasta", + "O=\"Mammoth_MT_Krause.dict\"" + ] + }, + "parents": [ + "makebwaindex_mammoth_mt_krause.fasta" + ], + "children": [ + "makefastaindex_mammoth_mt_krause.fasta" + ], + "files": [], + "cores": 1.0, + "id": "ID000003", + "category": "makeseqdict", + "avgCPU": 83.5, + "bytesRead": 22728, + "bytesWritten": 1300, + "memory": 104416 + }, + { + "name": "makefastaindex_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 170.797, + "command": { + "program": "makefastaindex", + "arguments": [ + "samtools", + "faidx", + "Mammoth_MT_Krause.fasta" + ] + }, + "parents": [ + "makeseqdict_mammoth_mt_krause.fasta" + ], + "children": [ + "output_documentation" + ], + "files": [], + "cores": 1.0, + "id": "ID000002", + "category": "makefastaindex", + "avgCPU": 23.8, + "bytesRead": 66, + "bytesWritten": 4, + "memory": 6096 + }, + { + "name": "output_documentation", + "type": "compute", + "runtime": 173.479, + "command": { + "program": "output_documentation", + "arguments": [ + "markdown_to_html.py", + "output.md", + "-o", + "results_description.html" + ] + }, + "parents": [ + "makefastaindex_mammoth_mt_krause.fasta" + ], + "children": [ + "get_software_versions" + ], + "files": [], + "cores": 1.0, + "id": "ID000005", + "category": "output_documentation", + "avgCPU": 84.0, + "bytesRead": 8222, + "bytesWritten": 15165, + "memory": 11488 + }, + { + "name": "get_software_versions", + "type": "compute", + "runtime": 183.445, + "command": { + "program": "get_software_versions", + "arguments": [ + "echo", + "2.3.5", + "&>", + "v_pipeline.txt", + "echo", + "21.04.3", + "&>", + "v_nextflow.txt", + "fastqc", + "--version", + "&>", + "v_fastqc.txt", + "2>&1", + "||", + "true", + "AdapterRemoval", + "--version", + "&>", + "v_adapterremoval.txt", + "2>&1", + "||", + "true", + "fastp", + "--version", + "&>", + "v_fastp.txt", + "2>&1", + "||", + "true", + "bwa", + "&>", + "v_bwa.txt", + "2>&1", + "||", + "true", + "circulargenerator", + "--help", + "|", + "head", + "-n", + "1", + "&>", + "v_circulargenerator.txt", + "2>&1", + "||", + "true", + "samtools", + "--version", + "&>", + "v_samtools.txt", + "2>&1", + "||", + "true", + "dedup", + "-v", + "&>", + "v_dedup.txt", + "2>&1", + "||", + "true", + "##", + "bioconda", + "recipe", + "of", + "picard", + "is", + "incorrectly", + "set", + "up", + "and", + "extra", + "warning", + "made", + "with", + "stderr,", + "this", + "ugly", + "command", + "ensures", + "only", + "version", + "exported", + "(", + "exec", + "7>&1", + "picard", + "MarkDuplicates", + "--version", + "2>&1", + ">&7", + "|", + "grep", + "-v", + "/", + ">&2", + ")", + "2>", + "v_markduplicates.txt", + "||", + "true", + "qualimap", + "--version", + "&>", + "v_qualimap.txt", + "2>&1", + "||", + "true", + "preseq", + "&>", + "v_preseq.txt", + "2>&1", + "||", + "true", + "gatk", + "--version", + "2>&1", + "|", + "head", + "-n", + "1", + ">", + "v_gatk.txt", + "2>&1", + "||", + "true", + "gatk3", + "--version", + "2>&1", + ">", + "v_gatk3.txt", + "2>&1", + "||", + "true", + "freebayes", + "--version", + "&>", + "v_freebayes.txt", + "2>&1", + "||", + "true", + "bedtools", + "--version", + "&>", + "v_bedtools.txt", + "2>&1", + "||", + "true", + "damageprofiler", + "--version", + "&>", + "v_damageprofiler.txt", + "2>&1", + "||", + "true", + "bam", + "--version", + "&>", + "v_bamutil.txt", + "2>&1", + "||", + "true", + "pmdtools", + "--version", + "&>", + "v_pmdtools.txt", + "2>&1", + "||", + "true", + "angsd", + "-h", + "|&", + "head", + "-n", + "1", + "|", + "cut", + "-d", + "-f3-4", + "&>", + "v_angsd.txt", + "2>&1", + "||", + "true", + "multivcfanalyzer", + "--help", + "|", + "head", + "-n", + "1", + "&>", + "v_multivcfanalyzer.txt", + "2>&1", + "||", + "true", + "malt-run", + "--help", + "|&", + "tail", + "-n", + "3", + "|", + "head", + "-n", + "1", + "|", + "cut", + "-f", + "2", + "-d(", + "|", + "cut", + "-f", + "1", + "-d", + ",", + "&>", + "v_malt.txt", + "2>&1", + "||", + "true", + "MaltExtract", + "--help", + "|", + "head", + "-n", + "2", + "|", + "tail", + "-n", + "1", + "&>", + "v_maltextract.txt", + "2>&1", + "||", + "true", + "multiqc", + "--version", + "&>", + "v_multiqc.txt", + "2>&1", + "||", + "true", + "vcf2genome", + "-h", + "|&", + "head", + "-n", + "1", + "&>", + "v_vcf2genome.txt", + "||", + "true", + "mtnucratio", + "--help", + "&>", + "v_mtnucratiocalculator.txt", + "||", + "true", + "sexdeterrmine", + "--version", + "&>", + "v_sexdeterrmine.txt", + "||", + "true", + "kraken2", + "--version", + "|", + "head", + "-n", + "1", + "&>", + "v_kraken.txt", + "||", + "true", + "endorS.py", + "--version", + "&>", + "v_endorSpy.txt", + "||", + "true", + "pileupCaller", + "--version", + "&>", + "v_sequencetools.txt", + "2>&1", + "||", + "true", + "bowtie2", + "--version", + "|", + "grep", + "-a", + "bowtie2-.*", + "-fdebug", + ">", + "v_bowtie2.txt", + "||", + "true", + "eigenstrat_snp_coverage", + "--version", + "|", + "cut", + "-d", + "-f2", + ">v_eigenstrat_snp_coverage.txt", + "||", + "true", + "mapDamage", + "--version", + ">", + "v_mapdamage.txt", + "||", + "true", + "bbduk.sh", + "|", + "grep", + "Last", + "modified", + "|", + "cut", + "-d", + "-f", + "3-99", + ">", + "v_bbduk.txt", + "||", + "true", + "scrape_software_versions.py", + "&>", + "software_versions_mqc.yaml" + ] + }, + "parents": [ + "output_documentation" + ], + "children": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000006", + "category": "get_software_versions", + "avgCPU": 147.8, + "bytesRead": 172760, + "bytesWritten": 1048, + "memory": 387324 + }, + { + "name": "fastqc_jk2782_l1", + "type": "compute", + "runtime": 175.205, + "command": { + "program": "fastqc", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz", + "rename", + "s/_fastqc.zip$/_raw_fastqc.zip/", + "*_fastqc.zip", + "rename", + "s/_fastqc.html$/_raw_fastqc.html/", + "*_fastqc.html" + ] + }, + "parents": [ + "get_software_versions" + ], + "children": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000007", + "category": "fastqc", + "avgCPU": 161.8, + "bytesRead": 35981, + "bytesWritten": 3967, + "memory": 270124 + }, + { + "name": "adapter_removal_jk2782_l1", + "type": "compute", + "runtime": 172.643, + "command": { + "program": "adapter_removal", + "arguments": [ + "mkdir", + "-p", + "output", + "AdapterRemoval", + "--file1", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "--file2", + "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz", + "--basename", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe", + "--gzip", + "--threads", + "2", + "--qualitymax", + "41", + "--collapse", + "--trimns", + "--trimqualities", + "--adapter1", + "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", + "--adapter2", + "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA", + "--minlength", + "30", + "--minquality", + "20", + "--minadapteroverlap", + "1", + "cat", + "*.collapsed.gz", + "*.collapsed.truncated.gz", + "*.singleton.truncated.gz", + "*.pair1.truncated.gz", + "*.pair2.truncated.gz", + ">", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz", + "mv", + "*.settings", + "output/", + "##", + "Add", + "R_", + "and", + "L_", + "for", + "unmerged", + "reads", + "for", + "DeDup", + "compatibility", + "AdapterRemovalFixPrefix", + "-Xmx4g", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz", + "|", + "pigz", + "-p", + "1", + ">", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz" + ] + }, + "parents": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "children": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000008", + "category": "adapter_removal", + "avgCPU": 160.9, + "bytesRead": 17357, + "bytesWritten": 4405, + "memory": 79308 + }, + { + "name": "fastqc_jk2802_l2", + "type": "compute", + "runtime": 177.338, + "command": { + "program": "fastqc", + "arguments": [ + "fastqc", + "-q", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "rename", + "s/_fastqc.zip$/_raw_fastqc.zip/", + "*_fastqc.zip", + "rename", + "s/_fastqc.html$/_raw_fastqc.html/", + "*_fastqc.html" + ] + }, + "parents": [ + "get_software_versions" + ], + "children": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000009", + "category": "fastqc", + "avgCPU": 120.1, + "bytesRead": 24457, + "bytesWritten": 2181, + "memory": 181060 + }, + { + "name": "adapter_removal_jk2802_l2", + "type": "compute", + "runtime": 174.313, + "command": { + "program": "adapter_removal", + "arguments": [ + "mkdir", + "-p", + "output", + "AdapterRemoval", + "--file1", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "--basename", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se", + "--gzip", + "--threads", + "2", + "--qualitymax", + "41", + "--trimns", + "--trimqualities", + "--adapter1", + "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", + "--adapter2", + "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA", + "--minlength", + "30", + "--minquality", + "20", + "--minadapteroverlap", + "1", + "mv", + "*.settings", + "*.se.truncated.gz", + "output/" + ] + }, + "parents": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "children": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000010", + "category": "adapter_removal", + "avgCPU": 106.5, + "bytesRead": 683, + "bytesWritten": 897, + "memory": 12136 + }, + { + "name": "fastqc_after_clipping_jk2782_l1", + "type": "compute", + "runtime": 15.371, + "command": { + "program": "fastqc_after_clipping", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz" + ] + }, + "parents": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "children": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "files": [], + "cores": 2.0, + "id": "ID000013", + "category": "fastqc_after_clipping", + "avgCPU": 133.3, + "bytesRead": 23788, + "bytesWritten": 1998, + "memory": 215020 + }, + { + "name": "fastqc_after_clipping_jk2802_l2", + "type": "compute", + "runtime": 15.272, + "command": { + "program": "fastqc_after_clipping", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz" + ] + }, + "parents": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "children": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "files": [], + "cores": 2.0, + "id": "ID000014", + "category": "fastqc_after_clipping", + "avgCPU": 124.1, + "bytesRead": 23882, + "bytesWritten": 2143, + "memory": 213064 + }, + { + "name": "bwa_jk2802", + "type": "compute", + "runtime": 9.566, + "command": { + "program": "bwa", + "arguments": [ + "bwa", + "aln", + "-t", + "2", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz", + "-n", + "0.04", + "-l", + "1024", + "-k", + "2", + "-o", + "1", + "-f", + "JK2802.sai", + "bwa", + "samse", + "-r", + "\"@RGtID:ILLUMINA-JK2802tSM:JK2802tPL:illuminatPU:ILLUMINA-JK2802-SE\"", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2802.sai", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz", + "|", + "samtools", + "sort", + "-@", + "1", + "-O", + "bam", + "-", + ">", + "\"JK2802\"_\"SE\".mapped.bam", + "samtools", + "index", + "\"JK2802\"_\"SE\".mapped.bam" + ] + }, + "parents": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "children": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000016", + "category": "bwa", + "avgCPU": 15.7, + "bytesRead": 3774, + "bytesWritten": 3367, + "memory": 10628 + }, + { + "name": "bwa_jk2782", + "type": "compute", + "runtime": 9.652, + "command": { + "program": "bwa", + "arguments": [ + "bwa", + "aln", + "-t", + "2", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz", + "-n", + "0.04", + "-l", + "1024", + "-k", + "2", + "-o", + "1", + "-f", + "JK2782.sai", + "bwa", + "samse", + "-r", + "\"@RGtID:ILLUMINA-JK2782tSM:JK2782tPL:illuminatPU:ILLUMINA-JK2782-PE\"", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2782.sai", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz", + "|", + "samtools", + "sort", + "-@", + "1", + "-O", + "bam", + "-", + ">", + "\"JK2782\"_\"PE\".mapped.bam", + "samtools", + "index", + "\"JK2782\"_\"PE\".mapped.bam" + ] + }, + "parents": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "children": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000015", + "category": "bwa", + "avgCPU": 69.8, + "bytesRead": 3705, + "bytesWritten": 3355, + "memory": 12876 + }, + { + "name": "samtools_flagstat_jk2782", + "type": "compute", + "runtime": 13.011, + "command": { + "program": "samtools_flagstat", + "arguments": [ + "samtools", + "flagstat", + "JK2782_PE.mapped.bam", + ">", + "JK2782_flagstat.stats" + ] + }, + "parents": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "children": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000026", + "category": "samtools_flagstat", + "avgCPU": 30.1, + "bytesRead": 478, + "bytesWritten": 5, + "memory": 6468 + }, + { + "name": "samtools_flagstat_jk2802", + "type": "compute", + "runtime": 13.129, + "command": { + "program": "samtools_flagstat", + "arguments": [ + "samtools", + "flagstat", + "JK2802_SE.mapped.bam", + ">", + "JK2802_flagstat.stats" + ] + }, + "parents": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "children": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000024", + "category": "samtools_flagstat", + "avgCPU": 118.5, + "bytesRead": 551, + "bytesWritten": 5 + }, + { + "name": "markduplicates_jk2782", + "type": "compute", + "runtime": 22.655, + "command": { + "program": "markduplicates", + "arguments": [ + "mv", + "JK2782_PE.mapped.bam", + "JK2782.bam", + "picard", + "-Xmx4096M", + "MarkDuplicates", + "INPUT=JK2782.bam", + "OUTPUT=JK2782_rmdup.bam", + "REMOVE_DUPLICATES=TRUE", + "AS=TRUE", + "METRICS_FILE=\"JK2782_rmdup.metrics\"", + "VALIDATION_STRINGENCY=SILENT", + "samtools", + "index", + "JK2782_rmdup.bam" + ] + }, + "parents": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "children": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000021", + "category": "markduplicates", + "avgCPU": 173.6, + "bytesRead": 24055, + "bytesWritten": 2319, + "memory": 1400048 + }, + { + "name": "markduplicates_jk2802", + "type": "compute", + "runtime": 21.545, + "command": { + "program": "markduplicates", + "arguments": [ + "mv", + "JK2802_SE.mapped.bam", + "JK2802.bam", + "picard", + "-Xmx4096M", + "MarkDuplicates", + "INPUT=JK2802.bam", + "OUTPUT=JK2802_rmdup.bam", + "REMOVE_DUPLICATES=TRUE", + "AS=TRUE", + "METRICS_FILE=\"JK2802_rmdup.metrics\"", + "VALIDATION_STRINGENCY=SILENT", + "samtools", + "index", + "JK2802_rmdup.bam" + ] + }, + "parents": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "children": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000020", + "category": "markduplicates", + "avgCPU": 182.6, + "bytesRead": 24242, + "bytesWritten": 2466, + "memory": 1404624 + }, + { + "name": "preseq_jk2782", + "type": "compute", + "runtime": 12.299, + "command": { + "program": "preseq", + "arguments": [ + "preseq", + "c_curve", + "-s", + "1000", + "-o", + "JK2782_PE.mapped.ccurve", + "-B", + "JK2782_PE.mapped.bam" + ] + }, + "parents": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "children": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000030", + "category": "preseq", + "avgCPU": 81.9, + "bytesRead": 473, + "bytesWritten": 4, + "memory": 12032 + }, + { + "name": "preseq_jk2802", + "type": "compute", + "runtime": 10.188, + "command": { + "program": "preseq", + "arguments": [ + "preseq", + "c_curve", + "-s", + "1000", + "-o", + "JK2802_SE.mapped.ccurve", + "-B", + "JK2802_SE.mapped.bam" + ] + }, + "parents": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "children": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000027", + "category": "preseq", + "avgCPU": 77.6, + "bytesRead": 548, + "bytesWritten": 4, + "memory": 11972 + }, + { + "name": "endorspy_jk2782", + "type": "compute", + "runtime": 7.537, + "command": { + "program": "endorspy", + "arguments": [ + "endorS.py", + "-o", + "json", + "-n", + "JK2782", + "JK2782_flagstat.stats" + ] + }, + "parents": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "children": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000031", + "category": "endorspy", + "avgCPU": 44.7, + "bytesRead": 623, + "bytesWritten": 4, + "memory": 12264 + }, + { + "name": "endorspy_jk2802", + "type": "compute", + "runtime": 8.0, + "command": { + "program": "endorspy", + "arguments": [ + "endorS.py", + "-o", + "json", + "-n", + "JK2802", + "JK2802_flagstat.stats" + ] + }, + "parents": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "children": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000032", + "category": "endorspy", + "avgCPU": 54.0, + "bytesRead": 623, + "bytesWritten": 4, + "memory": 12224 + }, + { + "name": "damageprofiler_jk2802", + "type": "compute", + "runtime": 18.596, + "command": { + "program": "damageprofiler", + "arguments": [ + "damageprofiler", + "-Xmx4g", + "-i", + "JK2802_rmdup.bam", + "-r", + "Mammoth_MT_Krause.fasta", + "-l", + "100", + "-t", + "15", + "-o", + ".", + "-yaxis_damageplot", + "0.30" + ] + }, + "parents": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "children": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000033", + "category": "damageprofiler", + "avgCPU": 88.6, + "bytesRead": 25744, + "bytesWritten": 391, + "memory": 242940 + }, + { + "name": "damageprofiler_jk2782", + "type": "compute", + "runtime": 16.736, + "command": { + "program": "damageprofiler", + "arguments": [ + "damageprofiler", + "-Xmx4g", + "-i", + "JK2782_rmdup.bam", + "-r", + "Mammoth_MT_Krause.fasta", + "-l", + "100", + "-t", + "15", + "-o", + ".", + "-yaxis_damageplot", + "0.30" + ] + }, + "parents": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "children": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000036", + "category": "damageprofiler", + "avgCPU": 88.3, + "bytesRead": 25661, + "bytesWritten": 327, + "memory": 198276 + }, + { + "name": "qualimap_jk2802", + "type": "compute", + "runtime": 15.368, + "command": { + "program": "qualimap", + "arguments": [ + "qualimap", + "bamqc", + "-bam", + "JK2802_rmdup.bam", + "-nt", + "2", + "-outdir", + ".", + "-outformat", + "\"HTML\"", + "--java-mem-size=4G" + ] + }, + "parents": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "children": [ + "multiqc_1" + ], + "files": [], + "cores": 2.0, + "id": "ID000053", + "category": "qualimap", + "avgCPU": 177.7, + "bytesRead": 35038, + "bytesWritten": 1712, + "memory": 209440 + }, + { + "name": "qualimap_jk2782", + "type": "compute", + "runtime": 14.223, + "command": { + "program": "qualimap", + "arguments": [ + "qualimap", + "bamqc", + "-bam", + "JK2782_rmdup.bam", + "-nt", + "2", + "-outdir", + ".", + "-outformat", + "\"HTML\"", + "--java-mem-size=4G" + ] + }, + "parents": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "children": [ + "multiqc_1" + ], + "files": [], + "cores": 2.0, + "id": "ID000054", + "category": "qualimap", + "avgCPU": 181.9, + "bytesRead": 34954, + "bytesWritten": 1937, + "memory": 232196 + }, + { + "name": "multiqc_1", + "type": "compute", + "runtime": 46.376, + "command": { + "program": "multiqc", + "arguments": [ + "multiqc", + "-f", + "multiqc_config.yaml", + "." + ] + }, + "parents": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "children": [], + "files": [], + "cores": 1.0, + "id": "ID000056", + "category": "multiqc", + "avgCPU": 93.0, + "bytesRead": 1215169, + "bytesWritten": 22599, + "memory": 139496 + } + ] + } +} |
