diff options
Diffstat (limited to 'opendc-trace/opendc-trace-wfformat/src')
6 files changed, 0 insertions, 2240 deletions
diff --git a/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReader.kt b/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReader.kt deleted file mode 100644 index 8f84e51f..00000000 --- a/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReader.kt +++ /dev/null @@ -1,314 +0,0 @@ -/* - * Copyright (c) 2021 AtLarge Research - * - * Permission is hereby granted, free of charge, to any person obtaining a copy - * of this software and associated documentation files (the "Software"), to deal - * in the Software without restriction, including without limitation the rights - * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the Software is - * furnished to do so, subject to the following conditions: - * - * The above copyright notice and this permission notice shall be included in all - * copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR - * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, - * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE - * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER - * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, - * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE - * SOFTWARE. - */ - -package org.opendc.trace.wfformat - -import com.fasterxml.jackson.core.JsonParseException -import com.fasterxml.jackson.core.JsonParser -import com.fasterxml.jackson.core.JsonToken -import org.opendc.trace.TableColumnType -import org.opendc.trace.TableReader -import org.opendc.trace.conv.TASK_CHILDREN -import org.opendc.trace.conv.TASK_ID -import org.opendc.trace.conv.TASK_PARENTS -import org.opendc.trace.conv.TASK_REQ_NCPUS -import org.opendc.trace.conv.TASK_RUNTIME -import org.opendc.trace.conv.TASK_WORKFLOW_ID -import org.opendc.trace.util.convertTo -import java.time.Duration -import java.time.Instant -import java.util.UUID -import kotlin.math.roundToInt - -/** - * A [TableReader] implementation for the WfCommons workload trace format. - */ -internal class WfFormatTaskTableReader(private val parser: JsonParser) : TableReader { - /** - * The current nesting of the parser. - */ - private var level: ParserLevel = ParserLevel.TOP - - override fun nextRow(): Boolean { - reset() - - var hasJob = false - - while (!hasJob) { - when (level) { - ParserLevel.TOP -> { - val token = parser.nextToken() - - // Check whether the document is not empty and starts with an object - if (token == null) { - parser.close() - break - } else if (token != JsonToken.START_OBJECT) { - throw JsonParseException(parser, "Expected object", parser.currentLocation) - } else { - level = ParserLevel.TRACE - } - } - ParserLevel.TRACE -> { - // Seek for the workflow object in the file - if (!seekWorkflow()) { - parser.close() - break - } else if (!parser.isExpectedStartObjectToken) { - throw JsonParseException(parser, "Expected object", parser.currentLocation) - } else { - level = ParserLevel.WORKFLOW - } - } - ParserLevel.WORKFLOW -> { - // Seek for the jobs object in the file - level = - if (!seekJobs()) { - ParserLevel.TRACE - } else if (!parser.isExpectedStartArrayToken) { - throw JsonParseException(parser, "Expected array", parser.currentLocation) - } else { - ParserLevel.JOB - } - } - ParserLevel.JOB -> { - when (parser.nextToken()) { - JsonToken.END_ARRAY -> level = ParserLevel.WORKFLOW - JsonToken.START_OBJECT -> { - parseJob() - hasJob = true - break - } - else -> throw JsonParseException(parser, "Unexpected token", parser.currentLocation) - } - } - } - } - - return hasJob - } - - override fun resolve(name: String): Int { - return when (name) { - TASK_ID -> colID - TASK_WORKFLOW_ID -> colWorkflowID - TASK_RUNTIME -> colRuntime - TASK_REQ_NCPUS -> colNproc - TASK_PARENTS -> colParents - TASK_CHILDREN -> colChildren - else -> -1 - } - } - - override fun isNull(index: Int): Boolean { - require(index in 0..colChildren) { "Invalid column value" } - return false - } - - override fun getBoolean(index: Int): Boolean { - throw IllegalArgumentException("Invalid column") - } - - override fun getInt(index: Int): Int { - checkActive() - return when (index) { - colNproc -> cores - else -> throw IllegalArgumentException("Invalid column") - } - } - - override fun getLong(index: Int): Long { - throw IllegalArgumentException("Invalid column") - } - - override fun getFloat(index: Int): Float { - throw IllegalArgumentException("Invalid column") - } - - override fun getDouble(index: Int): Double { - throw IllegalArgumentException("Invalid column") - } - - override fun getString(index: Int): String? { - checkActive() - return when (index) { - colID -> id - colWorkflowID -> workflowId - else -> throw IllegalArgumentException("Invalid column") - } - } - - override fun getUUID(index: Int): UUID? { - throw IllegalArgumentException("Invalid column") - } - - override fun getInstant(index: Int): Instant? { - throw IllegalArgumentException("Invalid column") - } - - override fun getDuration(index: Int): Duration? { - checkActive() - return when (index) { - colRuntime -> runtime - else -> throw IllegalArgumentException("Invalid column") - } - } - - override fun <T> getList( - index: Int, - elementType: Class<T>, - ): List<T>? { - throw IllegalArgumentException("Invalid column") - } - - override fun <T> getSet( - index: Int, - elementType: Class<T>, - ): Set<T>? { - checkActive() - return when (index) { - colParents -> typeParents.convertTo(parents, elementType) - colChildren -> typeChildren.convertTo(children, elementType) - else -> throw IllegalArgumentException("Invalid column") - } - } - - override fun <K, V> getMap( - index: Int, - keyType: Class<K>, - valueType: Class<V>, - ): Map<K, V>? { - throw IllegalArgumentException("Invalid column") - } - - override fun close() { - parser.close() - } - - /** - * Helper method to check if the reader is active. - */ - private fun checkActive() { - check(level != ParserLevel.TOP && !parser.isClosed) { "No active row. Did you call nextRow()?" } - } - - /** - * Parse the trace and seek until the workflow description. - */ - private fun seekWorkflow(): Boolean { - while (parser.nextValue() != JsonToken.END_OBJECT && !parser.isClosed) { - when (parser.currentName) { - "name" -> workflowId = parser.text - "workflow" -> return true - else -> parser.skipChildren() - } - } - - return false - } - - /** - * Parse the workflow description in the file and seek until the first job. - */ - private fun seekJobs(): Boolean { - while (parser.nextValue() != JsonToken.END_OBJECT) { - when (parser.currentName) { - "jobs" -> return true - else -> parser.skipChildren() - } - } - - return false - } - - /** - * Parse a single job in the file. - */ - private fun parseJob() { - while (parser.nextValue() != JsonToken.END_OBJECT) { - when (parser.currentName) { - "name" -> id = parser.text - "parents" -> parents = parseIds() - "children" -> children = parseIds() - "runtime" -> runtime = Duration.ofSeconds(parser.numberValue.toLong()) - "cores" -> cores = parser.floatValue.roundToInt() - else -> parser.skipChildren() - } - } - } - - /** - * Parse the parents/children of a job. - */ - private fun parseIds(): Set<String> { - if (!parser.isExpectedStartArrayToken) { - throw JsonParseException(parser, "Expected array", parser.currentLocation) - } - - val ids = mutableSetOf<String>() - - while (parser.nextToken() != JsonToken.END_ARRAY) { - if (parser.currentToken != JsonToken.VALUE_STRING) { - throw JsonParseException(parser, "Expected token", parser.currentLocation) - } - - ids.add(parser.valueAsString) - } - - return ids - } - - private enum class ParserLevel { - TOP, - TRACE, - WORKFLOW, - JOB, - } - - /** - * State fields for the parser. - */ - private var id: String? = null - private var workflowId: String? = null - private var runtime: Duration? = null - private var parents: Set<String>? = null - private var children: Set<String>? = null - private var cores = -1 - - private fun reset() { - id = null - runtime = null - parents = null - children = null - cores = -1 - } - - private val colID = 0 - private val colWorkflowID = 1 - private val colRuntime = 3 - private val colNproc = 4 - private val colParents = 5 - private val colChildren = 6 - - private val typeParents = TableColumnType.Set(TableColumnType.String) - private val typeChildren = TableColumnType.Set(TableColumnType.String) -} diff --git a/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormat.kt b/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormat.kt deleted file mode 100644 index 2178fac6..00000000 --- a/opendc-trace/opendc-trace-wfformat/src/main/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormat.kt +++ /dev/null @@ -1,95 +0,0 @@ -/* - * Copyright (c) 2021 AtLarge Research - * - * Permission is hereby granted, free of charge, to any person obtaining a copy - * of this software and associated documentation files (the "Software"), to deal - * in the Software without restriction, including without limitation the rights - * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the Software is - * furnished to do so, subject to the following conditions: - * - * The above copyright notice and this permission notice shall be included in all - * copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR - * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, - * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE - * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER - * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, - * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE - * SOFTWARE. - */ - -package org.opendc.trace.wfformat - -import com.fasterxml.jackson.core.JsonFactory -import org.opendc.trace.TableColumn -import org.opendc.trace.TableColumnType -import org.opendc.trace.TableReader -import org.opendc.trace.TableWriter -import org.opendc.trace.conv.TABLE_TASKS -import org.opendc.trace.conv.TASK_CHILDREN -import org.opendc.trace.conv.TASK_ID -import org.opendc.trace.conv.TASK_PARENTS -import org.opendc.trace.conv.TASK_REQ_NCPUS -import org.opendc.trace.conv.TASK_RUNTIME -import org.opendc.trace.conv.TASK_WORKFLOW_ID -import org.opendc.trace.spi.TableDetails -import org.opendc.trace.spi.TraceFormat -import java.nio.file.Path - -/** - * A [TraceFormat] implementation for the WfCommons workload trace format. - */ -public class WfFormatTraceFormat : TraceFormat { - /** - * The [JsonFactory] that is used to created JSON parsers. - */ - private val factory = JsonFactory() - - override val name: String = "wfformat" - - override fun create(path: Path) { - throw UnsupportedOperationException("Writing not supported for this format") - } - - override fun getTables(path: Path): List<String> = listOf(TABLE_TASKS) - - override fun getDetails( - path: Path, - table: String, - ): TableDetails { - return when (table) { - TABLE_TASKS -> - TableDetails( - listOf( - TableColumn(TASK_ID, TableColumnType.String), - TableColumn(TASK_WORKFLOW_ID, TableColumnType.String), - TableColumn(TASK_RUNTIME, TableColumnType.Duration), - TableColumn(TASK_REQ_NCPUS, TableColumnType.Int), - TableColumn(TASK_PARENTS, TableColumnType.Set(TableColumnType.String)), - TableColumn(TASK_CHILDREN, TableColumnType.Set(TableColumnType.String)), - ), - ) - else -> throw IllegalArgumentException("Table $table not supported") - } - } - - override fun newReader( - path: Path, - table: String, - projection: List<String>?, - ): TableReader { - return when (table) { - TABLE_TASKS -> WfFormatTaskTableReader(factory.createParser(path.toFile())) - else -> throw IllegalArgumentException("Table $table not supported") - } - } - - override fun newWriter( - path: Path, - table: String, - ): TableWriter { - throw UnsupportedOperationException("Writing not supported for this format") - } -} diff --git a/opendc-trace/opendc-trace-wfformat/src/main/resources/META-INF/services/org.opendc.trace.spi.TraceFormat b/opendc-trace/opendc-trace-wfformat/src/main/resources/META-INF/services/org.opendc.trace.spi.TraceFormat deleted file mode 100644 index ee3aa2f6..00000000 --- a/opendc-trace/opendc-trace-wfformat/src/main/resources/META-INF/services/org.opendc.trace.spi.TraceFormat +++ /dev/null @@ -1 +0,0 @@ -org.opendc.trace.wfformat.WfFormatTraceFormat diff --git a/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt deleted file mode 100644 index 618cdf7d..00000000 --- a/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTaskTableReaderTest.kt +++ /dev/null @@ -1,360 +0,0 @@ -/* - * Copyright (c) 2021 AtLarge Research - * - * Permission is hereby granted, free of charge, to any person obtaining a copy - * of this software and associated documentation files (the "Software"), to deal - * in the Software without restriction, including without limitation the rights - * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the Software is - * furnished to do so, subject to the following conditions: - * - * The above copyright notice and this permission notice shall be included in all - * copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR - * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, - * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE - * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER - * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, - * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE - * SOFTWARE. - */ - -package org.opendc.trace.wfformat - -import com.fasterxml.jackson.core.JsonFactory -import com.fasterxml.jackson.core.JsonParseException -import org.junit.jupiter.api.Assertions.assertEquals -import org.junit.jupiter.api.Assertions.assertFalse -import org.junit.jupiter.api.Assertions.assertTrue -import org.junit.jupiter.api.Test -import org.junit.jupiter.api.assertDoesNotThrow -import org.junit.jupiter.api.assertThrows -import org.opendc.trace.conv.TASK_ID -import org.opendc.trace.conv.TASK_PARENTS - -/** - * Test suite for the [WfFormatTaskTableReader] class. - */ -internal class WfFormatTaskTableReaderTest { - /** - * The [JsonFactory] used to construct the parser. - */ - private val factory = JsonFactory() - - @Test - fun testEmptyInput() { - val content = "" - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertFalse(reader.nextRow()) - reader.close() - } - - @Test - fun testTopLevelArrayInput() { - val content = "[]" - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertThrows<JsonParseException> { - while (reader.nextRow()) { - continue - } - } - - reader.close() - } - - @Test - fun testNoWorkflow() { - val content = - """ - { - "name": "eager-nextflow-chameleon" - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertDoesNotThrow { - while (reader.nextRow()) { - continue - } - } - - reader.close() - } - - @Test - fun testWorkflowArrayType() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": [] - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertThrows<JsonParseException> { - while (reader.nextRow()) { - continue - } - } - - reader.close() - } - - @Test - fun testWorkflowNullType() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": null - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertThrows<JsonParseException> { - while (reader.nextRow()) { - continue - } - } - - reader.close() - } - - @Test - fun testNoJobs() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { - - } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertDoesNotThrow { reader.nextRow() } - - reader.close() - } - - @Test - fun testJobsObjectType() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { "jobs": {} } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertThrows<JsonParseException> { reader.nextRow() } - - reader.close() - } - - @Test - fun testJobsNullType() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { "jobs": null } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertThrows<JsonParseException> { reader.nextRow() } - - reader.close() - } - - @Test - fun testJobsInvalidChildType() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { - "jobs": [1] - } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertThrows<JsonParseException> { reader.nextRow() } - - reader.close() - } - - @Test - fun testJobsValidChildType() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { - "jobs": [ - { - "name": "test" - } - ] - } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertTrue(reader.nextRow()) - assertEquals("test", reader.getString(TASK_ID)) - assertFalse(reader.nextRow()) - - reader.close() - } - - @Test - fun testJobsInvalidParents() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { - "jobs": [ - { - "name": "test", - "parents": 1, - } - ] - } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertThrows<JsonParseException> { reader.nextRow() } - - reader.close() - } - - @Test - fun testJobsInvalidParentsItem() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { - "jobs": [ - { - "name": "test", - "parents": [1], - } - ] - } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertThrows<JsonParseException> { reader.nextRow() } - - reader.close() - } - - @Test - fun testJobsValidParents() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { - "jobs": [ - { - "name": "test", - "parents": ["1"] - } - ] - } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertTrue(reader.nextRow()) - assertEquals(setOf("1"), reader.getSet(TASK_PARENTS, String::class.java)) - assertFalse(reader.nextRow()) - - reader.close() - } - - @Test - fun testJobsInvalidSecondEntry() { - val content = - """ - { - "workflow": { - "jobs": [ - { - "name": "test", - "parents": ["1"] - }, - "test" - ] - } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertDoesNotThrow { reader.nextRow() } - assertThrows<JsonParseException> { reader.nextRow() } - - reader.close() - } - - @Test - fun testDuplicateJobsArray() { - val content = - """ - { - "name": "eager-nextflow-chameleon", - "workflow": { - "jobs": [ - { - "name": "test", - "parents": ["1"] - } - ], - "jobs": [ - { - "name": "test2", - "parents": ["test"] - } - ] - } - } - """.trimIndent() - val parser = factory.createParser(content) - val reader = WfFormatTaskTableReader(parser) - - assertTrue(reader.nextRow()) - assertTrue(reader.nextRow()) - assertEquals("test2", reader.getString(TASK_ID)) - assertFalse(reader.nextRow()) - - reader.close() - } -} diff --git a/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt b/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt deleted file mode 100644 index 80a9d80e..00000000 --- a/opendc-trace/opendc-trace-wfformat/src/test/kotlin/org/opendc/trace/wfformat/WfFormatTraceFormatTest.kt +++ /dev/null @@ -1,128 +0,0 @@ -/* - * Copyright (c) 2021 AtLarge Research - * - * Permission is hereby granted, free of charge, to any person obtaining a copy - * of this software and associated documentation files (the "Software"), to deal - * in the Software without restriction, including without limitation the rights - * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the Software is - * furnished to do so, subject to the following conditions: - * - * The above copyright notice and this permission notice shall be included in all - * copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR - * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, - * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE - * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER - * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, - * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE - * SOFTWARE. - */ - -package org.opendc.trace.wfformat - -import org.junit.jupiter.api.Assertions.assertAll -import org.junit.jupiter.api.Assertions.assertEquals -import org.junit.jupiter.api.Assertions.assertTrue -import org.junit.jupiter.api.BeforeEach -import org.junit.jupiter.api.DisplayName -import org.junit.jupiter.api.Nested -import org.junit.jupiter.api.Test -import org.junit.jupiter.api.assertDoesNotThrow -import org.junit.jupiter.api.assertThrows -import org.opendc.trace.TableColumn -import org.opendc.trace.TableReader -import org.opendc.trace.conv.TABLE_TASKS -import org.opendc.trace.conv.TASK_ID -import org.opendc.trace.conv.TASK_PARENTS -import org.opendc.trace.conv.TASK_RUNTIME -import org.opendc.trace.conv.TASK_WORKFLOW_ID -import org.opendc.trace.testkit.TableReaderTestKit -import java.nio.file.Paths - -/** - * Test suite for the [WfFormatTraceFormat] class. - */ -@DisplayName("WfFormat TraceFormat") -class WfFormatTraceFormatTest { - private val format = WfFormatTraceFormat() - - @Test - fun testTables() { - val path = Paths.get("src/test/resources/trace.json") - - assertEquals(listOf(TABLE_TASKS), format.getTables(path)) - } - - @Test - fun testTableExists() { - val path = Paths.get("src/test/resources/trace.json") - assertDoesNotThrow { format.getDetails(path, TABLE_TASKS) } - } - - @Test - fun testTableDoesNotExist() { - val path = Paths.get("src/test/resources/trace.json") - - assertThrows<IllegalArgumentException> { format.getDetails(path, "test") } - } - - /** - * Smoke test for parsing WfCommons traces. - */ - @Test - fun testTableReader() { - val path = Paths.get("src/test/resources/trace.json") - val reader = format.newReader(path, TABLE_TASKS, null) - - assertAll( - { assertTrue(reader.nextRow()) }, - { assertEquals("makebwaindex_mammoth_mt_krause.fasta", reader.getString(TASK_ID)) }, - { assertEquals("eager-nextflow-chameleon", reader.getString(TASK_WORKFLOW_ID)) }, - { assertEquals(172000, reader.getDuration(TASK_RUNTIME)?.toMillis()) }, - { assertEquals(emptySet<String>(), reader.getSet(TASK_PARENTS, String::class.java)) }, - ) - - assertAll( - { assertTrue(reader.nextRow()) }, - { assertEquals("makeseqdict_mammoth_mt_krause.fasta", reader.getString(TASK_ID)) }, - { assertEquals("eager-nextflow-chameleon", reader.getString(TASK_WORKFLOW_ID)) }, - { assertEquals(175000, reader.getDuration(TASK_RUNTIME)?.toMillis()) }, - { assertEquals(setOf("makebwaindex_mammoth_mt_krause.fasta"), reader.getSet(TASK_PARENTS, String::class.java)) }, - ) - - reader.close() - } - - /** - * Test full iteration of the table. - */ - @Test - fun testTableReaderFull() { - val path = Paths.get("src/test/resources/trace.json") - val reader = format.newReader(path, TABLE_TASKS, null) - - assertDoesNotThrow { - while (reader.nextRow()) { - // reader.get(TASK_ID) - } - reader.close() - } - } - - @DisplayName("TableReader for Tasks") - @Nested - inner class TasksTableReaderTest : TableReaderTestKit() { - override lateinit var reader: TableReader - override lateinit var columns: List<TableColumn> - - @BeforeEach - fun setUp() { - val path = Paths.get("src/test/resources/trace.json") - - columns = format.getDetails(path, TABLE_TASKS).columns - reader = format.newReader(path, TABLE_TASKS, null) - } - } -} diff --git a/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json b/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json deleted file mode 100644 index d21f024d..00000000 --- a/opendc-trace/opendc-trace-wfformat/src/test/resources/trace.json +++ /dev/null @@ -1,1342 +0,0 @@ -{ - "name": "eager-nextflow-chameleon", - "description": "Instance generated with WfCommons - https://wfcommons.org", - "createdAt": "2021-09-06T03:43:31.762479", - "schemaVersion": "1.2", - "author": { - "name": "cc", - "email": "support@wfcommons.org" - }, - "wms": { - "name": "Nextflow", - "version": "21.04.3", - "url": "https://www.nextflow.io" - }, - "workflow": { - "executedAt": "20210906T034331+0000", - "makespan": 275, - "jobs": [ - { - "name": "makebwaindex_mammoth_mt_krause.fasta", - "type": "compute", - "runtime": 172.182, - "command": { - "program": "makebwaindex", - "arguments": [ - "bwa", - "index", - "Mammoth_MT_Krause.fasta", - "mkdir", - "BWAIndex", - "&&", - "mv", - "Mammoth_MT_Krause.fasta*", - "BWAIndex" - ] - }, - "parents": [], - "children": [ - "makeseqdict_mammoth_mt_krause.fasta" - ], - "files": [], - "cores": 1.0, - "id": "ID000001", - "category": "makebwaindex", - "avgCPU": 5.8, - "bytesRead": 124, - "bytesWritten": 126, - "memory": 4248 - }, - { - "name": "makeseqdict_mammoth_mt_krause.fasta", - "type": "compute", - "runtime": 175.427, - "command": { - "program": "makeseqdict", - "arguments": [ - "picard", - "-Xmx6144M", - "CreateSequenceDictionary", - "R=Mammoth_MT_Krause.fasta", - "O=\"Mammoth_MT_Krause.dict\"" - ] - }, - "parents": [ - "makebwaindex_mammoth_mt_krause.fasta" - ], - "children": [ - "makefastaindex_mammoth_mt_krause.fasta" - ], - "files": [], - "cores": 1.0, - "id": "ID000003", - "category": "makeseqdict", - "avgCPU": 83.5, - "bytesRead": 22728, - "bytesWritten": 1300, - "memory": 104416 - }, - { - "name": "makefastaindex_mammoth_mt_krause.fasta", - "type": "compute", - "runtime": 170.797, - "command": { - "program": "makefastaindex", - "arguments": [ - "samtools", - "faidx", - "Mammoth_MT_Krause.fasta" - ] - }, - "parents": [ - "makeseqdict_mammoth_mt_krause.fasta" - ], - "children": [ - "output_documentation" - ], - "files": [], - "cores": 1.0, - "id": "ID000002", - "category": "makefastaindex", - "avgCPU": 23.8, - "bytesRead": 66, - "bytesWritten": 4, - "memory": 6096 - }, - { - "name": "output_documentation", - "type": "compute", - "runtime": 173.479, - "command": { - "program": "output_documentation", - "arguments": [ - "markdown_to_html.py", - "output.md", - "-o", - "results_description.html" - ] - }, - "parents": [ - "makefastaindex_mammoth_mt_krause.fasta" - ], - "children": [ - "get_software_versions" - ], - "files": [], - "cores": 1.0, - "id": "ID000005", - "category": "output_documentation", - "avgCPU": 84.0, - "bytesRead": 8222, - "bytesWritten": 15165, - "memory": 11488 - }, - { - "name": "get_software_versions", - "type": "compute", - "runtime": 183.445, - "command": { - "program": "get_software_versions", - "arguments": [ - "echo", - "2.3.5", - "&>", - "v_pipeline.txt", - "echo", - "21.04.3", - "&>", - "v_nextflow.txt", - "fastqc", - "--version", - "&>", - "v_fastqc.txt", - "2>&1", - "||", - "true", - "AdapterRemoval", - "--version", - "&>", - "v_adapterremoval.txt", - "2>&1", - "||", - "true", - "fastp", - "--version", - "&>", - "v_fastp.txt", - "2>&1", - "||", - "true", - "bwa", - "&>", - "v_bwa.txt", - "2>&1", - "||", - "true", - "circulargenerator", - "--help", - "|", - "head", - "-n", - "1", - "&>", - "v_circulargenerator.txt", - "2>&1", - "||", - "true", - "samtools", - "--version", - "&>", - "v_samtools.txt", - "2>&1", - "||", - "true", - "dedup", - "-v", - "&>", - "v_dedup.txt", - "2>&1", - "||", - "true", - "##", - "bioconda", - "recipe", - "of", - "picard", - "is", - "incorrectly", - "set", - "up", - "and", - "extra", - "warning", - "made", - "with", - "stderr,", - "this", - "ugly", - "command", - "ensures", - "only", - "version", - "exported", - "(", - "exec", - "7>&1", - "picard", - "MarkDuplicates", - "--version", - "2>&1", - ">&7", - "|", - "grep", - "-v", - "/", - ">&2", - ")", - "2>", - "v_markduplicates.txt", - "||", - "true", - "qualimap", - "--version", - "&>", - "v_qualimap.txt", - "2>&1", - "||", - "true", - "preseq", - "&>", - "v_preseq.txt", - "2>&1", - "||", - "true", - "gatk", - "--version", - "2>&1", - "|", - "head", - "-n", - "1", - ">", - "v_gatk.txt", - "2>&1", - "||", - "true", - "gatk3", - "--version", - "2>&1", - ">", - "v_gatk3.txt", - "2>&1", - "||", - "true", - "freebayes", - "--version", - "&>", - "v_freebayes.txt", - "2>&1", - "||", - "true", - "bedtools", - "--version", - "&>", - "v_bedtools.txt", - "2>&1", - "||", - "true", - "damageprofiler", - "--version", - "&>", - "v_damageprofiler.txt", - "2>&1", - "||", - "true", - "bam", - "--version", - "&>", - "v_bamutil.txt", - "2>&1", - "||", - "true", - "pmdtools", - "--version", - "&>", - "v_pmdtools.txt", - "2>&1", - "||", - "true", - "angsd", - "-h", - "|&", - "head", - "-n", - "1", - "|", - "cut", - "-d", - "-f3-4", - "&>", - "v_angsd.txt", - "2>&1", - "||", - "true", - "multivcfanalyzer", - "--help", - "|", - "head", - "-n", - "1", - "&>", - "v_multivcfanalyzer.txt", - "2>&1", - "||", - "true", - "malt-run", - "--help", - "|&", - "tail", - "-n", - "3", - "|", - "head", - "-n", - "1", - "|", - "cut", - "-f", - "2", - "-d(", - "|", - "cut", - "-f", - "1", - "-d", - ",", - "&>", - "v_malt.txt", - "2>&1", - "||", - "true", - "MaltExtract", - "--help", - "|", - "head", - "-n", - "2", - "|", - "tail", - "-n", - "1", - "&>", - "v_maltextract.txt", - "2>&1", - "||", - "true", - "multiqc", - "--version", - "&>", - "v_multiqc.txt", - "2>&1", - "||", - "true", - "vcf2genome", - "-h", - "|&", - "head", - "-n", - "1", - "&>", - "v_vcf2genome.txt", - "||", - "true", - "mtnucratio", - "--help", - "&>", - "v_mtnucratiocalculator.txt", - "||", - "true", - "sexdeterrmine", - "--version", - "&>", - "v_sexdeterrmine.txt", - "||", - "true", - "kraken2", - "--version", - "|", - "head", - "-n", - "1", - "&>", - "v_kraken.txt", - "||", - "true", - "endorS.py", - "--version", - "&>", - "v_endorSpy.txt", - "||", - "true", - "pileupCaller", - "--version", - "&>", - "v_sequencetools.txt", - "2>&1", - "||", - "true", - "bowtie2", - "--version", - "|", - "grep", - "-a", - "bowtie2-.*", - "-fdebug", - ">", - "v_bowtie2.txt", - "||", - "true", - "eigenstrat_snp_coverage", - "--version", - "|", - "cut", - "-d", - "-f2", - ">v_eigenstrat_snp_coverage.txt", - "||", - "true", - "mapDamage", - "--version", - ">", - "v_mapdamage.txt", - "||", - "true", - "bbduk.sh", - "|", - "grep", - "Last", - "modified", - "|", - "cut", - "-d", - "-f", - "3-99", - ">", - "v_bbduk.txt", - "||", - "true", - "scrape_software_versions.py", - "&>", - "software_versions_mqc.yaml" - ] - }, - "parents": [ - "output_documentation" - ], - "children": [ - "fastqc_jk2782_l1", - "fastqc_jk2802_l2" - ], - "files": [], - "cores": 2.0, - "id": "ID000006", - "category": "get_software_versions", - "avgCPU": 147.8, - "bytesRead": 172760, - "bytesWritten": 1048, - "memory": 387324 - }, - { - "name": "fastqc_jk2782_l1", - "type": "compute", - "runtime": 175.205, - "command": { - "program": "fastqc", - "arguments": [ - "fastqc", - "-t", - "2", - "-q", - "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz", - "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz", - "rename", - "s/_fastqc.zip$/_raw_fastqc.zip/", - "*_fastqc.zip", - "rename", - "s/_fastqc.html$/_raw_fastqc.html/", - "*_fastqc.html" - ] - }, - "parents": [ - "get_software_versions" - ], - "children": [ - "adapter_removal_jk2782_l1", - "adapter_removal_jk2802_l2" - ], - "files": [], - "cores": 2.0, - "id": "ID000007", - "category": "fastqc", - "avgCPU": 161.8, - "bytesRead": 35981, - "bytesWritten": 3967, - "memory": 270124 - }, - { - "name": "adapter_removal_jk2782_l1", - "type": "compute", - "runtime": 172.643, - "command": { - "program": "adapter_removal", - "arguments": [ - "mkdir", - "-p", - "output", - "AdapterRemoval", - "--file1", - "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz", - "--file2", - "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz", - "--basename", - "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe", - "--gzip", - "--threads", - "2", - "--qualitymax", - "41", - "--collapse", - "--trimns", - "--trimqualities", - "--adapter1", - "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", - "--adapter2", - "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA", - "--minlength", - "30", - "--minquality", - "20", - "--minadapteroverlap", - "1", - "cat", - "*.collapsed.gz", - "*.collapsed.truncated.gz", - "*.singleton.truncated.gz", - "*.pair1.truncated.gz", - "*.pair2.truncated.gz", - ">", - "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz", - "mv", - "*.settings", - "output/", - "##", - "Add", - "R_", - "and", - "L_", - "for", - "unmerged", - "reads", - "for", - "DeDup", - "compatibility", - "AdapterRemovalFixPrefix", - "-Xmx4g", - "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz", - "|", - "pigz", - "-p", - "1", - ">", - "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz" - ] - }, - "parents": [ - "fastqc_jk2782_l1", - "fastqc_jk2802_l2" - ], - "children": [ - "fastqc_after_clipping_jk2782_l1", - "fastqc_after_clipping_jk2802_l2" - ], - "files": [], - "cores": 2.0, - "id": "ID000008", - "category": "adapter_removal", - "avgCPU": 160.9, - "bytesRead": 17357, - "bytesWritten": 4405, - "memory": 79308 - }, - { - "name": "fastqc_jk2802_l2", - "type": "compute", - "runtime": 177.338, - "command": { - "program": "fastqc", - "arguments": [ - "fastqc", - "-q", - "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz", - "rename", - "s/_fastqc.zip$/_raw_fastqc.zip/", - "*_fastqc.zip", - "rename", - "s/_fastqc.html$/_raw_fastqc.html/", - "*_fastqc.html" - ] - }, - "parents": [ - "get_software_versions" - ], - "children": [ - "adapter_removal_jk2782_l1", - "adapter_removal_jk2802_l2" - ], - "files": [], - "cores": 2.0, - "id": "ID000009", - "category": "fastqc", - "avgCPU": 120.1, - "bytesRead": 24457, - "bytesWritten": 2181, - "memory": 181060 - }, - { - "name": "adapter_removal_jk2802_l2", - "type": "compute", - "runtime": 174.313, - "command": { - "program": "adapter_removal", - "arguments": [ - "mkdir", - "-p", - "output", - "AdapterRemoval", - "--file1", - "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz", - "--basename", - "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se", - "--gzip", - "--threads", - "2", - "--qualitymax", - "41", - "--trimns", - "--trimqualities", - "--adapter1", - "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", - "--adapter2", - "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA", - "--minlength", - "30", - "--minquality", - "20", - "--minadapteroverlap", - "1", - "mv", - "*.settings", - "*.se.truncated.gz", - "output/" - ] - }, - "parents": [ - "fastqc_jk2782_l1", - "fastqc_jk2802_l2" - ], - "children": [ - "fastqc_after_clipping_jk2782_l1", - "fastqc_after_clipping_jk2802_l2" - ], - "files": [], - "cores": 2.0, - "id": "ID000010", - "category": "adapter_removal", - "avgCPU": 106.5, - "bytesRead": 683, - "bytesWritten": 897, - "memory": 12136 - }, - { - "name": "fastqc_after_clipping_jk2782_l1", - "type": "compute", - "runtime": 15.371, - "command": { - "program": "fastqc_after_clipping", - "arguments": [ - "fastqc", - "-t", - "2", - "-q", - "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz" - ] - }, - "parents": [ - "adapter_removal_jk2782_l1", - "adapter_removal_jk2802_l2" - ], - "children": [ - "bwa_jk2802", - "bwa_jk2782" - ], - "files": [], - "cores": 2.0, - "id": "ID000013", - "category": "fastqc_after_clipping", - "avgCPU": 133.3, - "bytesRead": 23788, - "bytesWritten": 1998, - "memory": 215020 - }, - { - "name": "fastqc_after_clipping_jk2802_l2", - "type": "compute", - "runtime": 15.272, - "command": { - "program": "fastqc_after_clipping", - "arguments": [ - "fastqc", - "-t", - "2", - "-q", - "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz" - ] - }, - "parents": [ - "adapter_removal_jk2782_l1", - "adapter_removal_jk2802_l2" - ], - "children": [ - "bwa_jk2802", - "bwa_jk2782" - ], - "files": [], - "cores": 2.0, - "id": "ID000014", - "category": "fastqc_after_clipping", - "avgCPU": 124.1, - "bytesRead": 23882, - "bytesWritten": 2143, - "memory": 213064 - }, - { - "name": "bwa_jk2802", - "type": "compute", - "runtime": 9.566, - "command": { - "program": "bwa", - "arguments": [ - "bwa", - "aln", - "-t", - "2", - "BWAIndex/Mammoth_MT_Krause.fasta", - "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz", - "-n", - "0.04", - "-l", - "1024", - "-k", - "2", - "-o", - "1", - "-f", - "JK2802.sai", - "bwa", - "samse", - "-r", - "\"@RGtID:ILLUMINA-JK2802tSM:JK2802tPL:illuminatPU:ILLUMINA-JK2802-SE\"", - "BWAIndex/Mammoth_MT_Krause.fasta", - "JK2802.sai", - "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz", - "|", - "samtools", - "sort", - "-@", - "1", - "-O", - "bam", - "-", - ">", - "\"JK2802\"_\"SE\".mapped.bam", - "samtools", - "index", - "\"JK2802\"_\"SE\".mapped.bam" - ] - }, - "parents": [ - "fastqc_after_clipping_jk2782_l1", - "fastqc_after_clipping_jk2802_l2" - ], - "children": [ - "samtools_flagstat_jk2782", - "samtools_flagstat_jk2802" - ], - "files": [], - "cores": 2.0, - "id": "ID000016", - "category": "bwa", - "avgCPU": 15.7, - "bytesRead": 3774, - "bytesWritten": 3367, - "memory": 10628 - }, - { - "name": "bwa_jk2782", - "type": "compute", - "runtime": 9.652, - "command": { - "program": "bwa", - "arguments": [ - "bwa", - "aln", - "-t", - "2", - "BWAIndex/Mammoth_MT_Krause.fasta", - "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz", - "-n", - "0.04", - "-l", - "1024", - "-k", - "2", - "-o", - "1", - "-f", - "JK2782.sai", - "bwa", - "samse", - "-r", - "\"@RGtID:ILLUMINA-JK2782tSM:JK2782tPL:illuminatPU:ILLUMINA-JK2782-PE\"", - "BWAIndex/Mammoth_MT_Krause.fasta", - "JK2782.sai", - "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz", - "|", - "samtools", - "sort", - "-@", - "1", - "-O", - "bam", - "-", - ">", - "\"JK2782\"_\"PE\".mapped.bam", - "samtools", - "index", - "\"JK2782\"_\"PE\".mapped.bam" - ] - }, - "parents": [ - "fastqc_after_clipping_jk2782_l1", - "fastqc_after_clipping_jk2802_l2" - ], - "children": [ - "samtools_flagstat_jk2782", - "samtools_flagstat_jk2802" - ], - "files": [], - "cores": 2.0, - "id": "ID000015", - "category": "bwa", - "avgCPU": 69.8, - "bytesRead": 3705, - "bytesWritten": 3355, - "memory": 12876 - }, - { - "name": "samtools_flagstat_jk2782", - "type": "compute", - "runtime": 13.011, - "command": { - "program": "samtools_flagstat", - "arguments": [ - "samtools", - "flagstat", - "JK2782_PE.mapped.bam", - ">", - "JK2782_flagstat.stats" - ] - }, - "parents": [ - "bwa_jk2802", - "bwa_jk2782" - ], - "children": [ - "markduplicates_jk2782", - "markduplicates_jk2802" - ], - "files": [], - "cores": 1.0, - "id": "ID000026", - "category": "samtools_flagstat", - "avgCPU": 30.1, - "bytesRead": 478, - "bytesWritten": 5, - "memory": 6468 - }, - { - "name": "samtools_flagstat_jk2802", - "type": "compute", - "runtime": 13.129, - "command": { - "program": "samtools_flagstat", - "arguments": [ - "samtools", - "flagstat", - "JK2802_SE.mapped.bam", - ">", - "JK2802_flagstat.stats" - ] - }, - "parents": [ - "bwa_jk2802", - "bwa_jk2782" - ], - "children": [ - "markduplicates_jk2782", - "markduplicates_jk2802" - ], - "files": [], - "cores": 1.0, - "id": "ID000024", - "category": "samtools_flagstat", - "avgCPU": 118.5, - "bytesRead": 551, - "bytesWritten": 5 - }, - { - "name": "markduplicates_jk2782", - "type": "compute", - "runtime": 22.655, - "command": { - "program": "markduplicates", - "arguments": [ - "mv", - "JK2782_PE.mapped.bam", - "JK2782.bam", - "picard", - "-Xmx4096M", - "MarkDuplicates", - "INPUT=JK2782.bam", - "OUTPUT=JK2782_rmdup.bam", - "REMOVE_DUPLICATES=TRUE", - "AS=TRUE", - "METRICS_FILE=\"JK2782_rmdup.metrics\"", - "VALIDATION_STRINGENCY=SILENT", - "samtools", - "index", - "JK2782_rmdup.bam" - ] - }, - "parents": [ - "samtools_flagstat_jk2782", - "samtools_flagstat_jk2802" - ], - "children": [ - "preseq_jk2782", - "preseq_jk2802" - ], - "files": [], - "cores": 2.0, - "id": "ID000021", - "category": "markduplicates", - "avgCPU": 173.6, - "bytesRead": 24055, - "bytesWritten": 2319, - "memory": 1400048 - }, - { - "name": "markduplicates_jk2802", - "type": "compute", - "runtime": 21.545, - "command": { - "program": "markduplicates", - "arguments": [ - "mv", - "JK2802_SE.mapped.bam", - "JK2802.bam", - "picard", - "-Xmx4096M", - "MarkDuplicates", - "INPUT=JK2802.bam", - "OUTPUT=JK2802_rmdup.bam", - "REMOVE_DUPLICATES=TRUE", - "AS=TRUE", - "METRICS_FILE=\"JK2802_rmdup.metrics\"", - "VALIDATION_STRINGENCY=SILENT", - "samtools", - "index", - "JK2802_rmdup.bam" - ] - }, - "parents": [ - "samtools_flagstat_jk2782", - "samtools_flagstat_jk2802" - ], - "children": [ - "preseq_jk2782", - "preseq_jk2802" - ], - "files": [], - "cores": 2.0, - "id": "ID000020", - "category": "markduplicates", - "avgCPU": 182.6, - "bytesRead": 24242, - "bytesWritten": 2466, - "memory": 1404624 - }, - { - "name": "preseq_jk2782", - "type": "compute", - "runtime": 12.299, - "command": { - "program": "preseq", - "arguments": [ - "preseq", - "c_curve", - "-s", - "1000", - "-o", - "JK2782_PE.mapped.ccurve", - "-B", - "JK2782_PE.mapped.bam" - ] - }, - "parents": [ - "markduplicates_jk2782", - "markduplicates_jk2802" - ], - "children": [ - "endorspy_jk2782", - "endorspy_jk2802" - ], - "files": [], - "cores": 1.0, - "id": "ID000030", - "category": "preseq", - "avgCPU": 81.9, - "bytesRead": 473, - "bytesWritten": 4, - "memory": 12032 - }, - { - "name": "preseq_jk2802", - "type": "compute", - "runtime": 10.188, - "command": { - "program": "preseq", - "arguments": [ - "preseq", - "c_curve", - "-s", - "1000", - "-o", - "JK2802_SE.mapped.ccurve", - "-B", - "JK2802_SE.mapped.bam" - ] - }, - "parents": [ - "markduplicates_jk2782", - "markduplicates_jk2802" - ], - "children": [ - "endorspy_jk2782", - "endorspy_jk2802" - ], - "files": [], - "cores": 1.0, - "id": "ID000027", - "category": "preseq", - "avgCPU": 77.6, - "bytesRead": 548, - "bytesWritten": 4, - "memory": 11972 - }, - { - "name": "endorspy_jk2782", - "type": "compute", - "runtime": 7.537, - "command": { - "program": "endorspy", - "arguments": [ - "endorS.py", - "-o", - "json", - "-n", - "JK2782", - "JK2782_flagstat.stats" - ] - }, - "parents": [ - "preseq_jk2782", - "preseq_jk2802" - ], - "children": [ - "damageprofiler_jk2802", - "damageprofiler_jk2782" - ], - "files": [], - "cores": 1.0, - "id": "ID000031", - "category": "endorspy", - "avgCPU": 44.7, - "bytesRead": 623, - "bytesWritten": 4, - "memory": 12264 - }, - { - "name": "endorspy_jk2802", - "type": "compute", - "runtime": 8.0, - "command": { - "program": "endorspy", - "arguments": [ - "endorS.py", - "-o", - "json", - "-n", - "JK2802", - "JK2802_flagstat.stats" - ] - }, - "parents": [ - "preseq_jk2782", - "preseq_jk2802" - ], - "children": [ - "damageprofiler_jk2802", - "damageprofiler_jk2782" - ], - "files": [], - "cores": 1.0, - "id": "ID000032", - "category": "endorspy", - "avgCPU": 54.0, - "bytesRead": 623, - "bytesWritten": 4, - "memory": 12224 - }, - { - "name": "damageprofiler_jk2802", - "type": "compute", - "runtime": 18.596, - "command": { - "program": "damageprofiler", - "arguments": [ - "damageprofiler", - "-Xmx4g", - "-i", - "JK2802_rmdup.bam", - "-r", - "Mammoth_MT_Krause.fasta", - "-l", - "100", - "-t", - "15", - "-o", - ".", - "-yaxis_damageplot", - "0.30" - ] - }, - "parents": [ - "endorspy_jk2782", - "endorspy_jk2802" - ], - "children": [ - "qualimap_jk2802", - "qualimap_jk2782" - ], - "files": [], - "cores": 1.0, - "id": "ID000033", - "category": "damageprofiler", - "avgCPU": 88.6, - "bytesRead": 25744, - "bytesWritten": 391, - "memory": 242940 - }, - { - "name": "damageprofiler_jk2782", - "type": "compute", - "runtime": 16.736, - "command": { - "program": "damageprofiler", - "arguments": [ - "damageprofiler", - "-Xmx4g", - "-i", - "JK2782_rmdup.bam", - "-r", - "Mammoth_MT_Krause.fasta", - "-l", - "100", - "-t", - "15", - "-o", - ".", - "-yaxis_damageplot", - "0.30" - ] - }, - "parents": [ - "endorspy_jk2782", - "endorspy_jk2802" - ], - "children": [ - "qualimap_jk2802", - "qualimap_jk2782" - ], - "files": [], - "cores": 1.0, - "id": "ID000036", - "category": "damageprofiler", - "avgCPU": 88.3, - "bytesRead": 25661, - "bytesWritten": 327, - "memory": 198276 - }, - { - "name": "qualimap_jk2802", - "type": "compute", - "runtime": 15.368, - "command": { - "program": "qualimap", - "arguments": [ - "qualimap", - "bamqc", - "-bam", - "JK2802_rmdup.bam", - "-nt", - "2", - "-outdir", - ".", - "-outformat", - "\"HTML\"", - "--java-mem-size=4G" - ] - }, - "parents": [ - "damageprofiler_jk2802", - "damageprofiler_jk2782" - ], - "children": [ - "multiqc_1" - ], - "files": [], - "cores": 2.0, - "id": "ID000053", - "category": "qualimap", - "avgCPU": 177.7, - "bytesRead": 35038, - "bytesWritten": 1712, - "memory": 209440 - }, - { - "name": "qualimap_jk2782", - "type": "compute", - "runtime": 14.223, - "command": { - "program": "qualimap", - "arguments": [ - "qualimap", - "bamqc", - "-bam", - "JK2782_rmdup.bam", - "-nt", - "2", - "-outdir", - ".", - "-outformat", - "\"HTML\"", - "--java-mem-size=4G" - ] - }, - "parents": [ - "damageprofiler_jk2802", - "damageprofiler_jk2782" - ], - "children": [ - "multiqc_1" - ], - "files": [], - "cores": 2.0, - "id": "ID000054", - "category": "qualimap", - "avgCPU": 181.9, - "bytesRead": 34954, - "bytesWritten": 1937, - "memory": 232196 - }, - { - "name": "multiqc_1", - "type": "compute", - "runtime": 46.376, - "command": { - "program": "multiqc", - "arguments": [ - "multiqc", - "-f", - "multiqc_config.yaml", - "." - ] - }, - "parents": [ - "qualimap_jk2802", - "qualimap_jk2782" - ], - "children": [], - "files": [], - "cores": 1.0, - "id": "ID000056", - "category": "multiqc", - "avgCPU": 93.0, - "bytesRead": 1215169, - "bytesWritten": 22599, - "memory": 139496 - } - ] - } -} |