summaryrefslogtreecommitdiff
path: root/opendc-trace/opendc-trace-api/src/test/resources/wfformat
diff options
context:
space:
mode:
Diffstat (limited to 'opendc-trace/opendc-trace-api/src/test/resources/wfformat')
-rw-r--r--opendc-trace/opendc-trace-api/src/test/resources/wfformat/trace.json1342
1 files changed, 1342 insertions, 0 deletions
diff --git a/opendc-trace/opendc-trace-api/src/test/resources/wfformat/trace.json b/opendc-trace/opendc-trace-api/src/test/resources/wfformat/trace.json
new file mode 100644
index 00000000..d21f024d
--- /dev/null
+++ b/opendc-trace/opendc-trace-api/src/test/resources/wfformat/trace.json
@@ -0,0 +1,1342 @@
+{
+ "name": "eager-nextflow-chameleon",
+ "description": "Instance generated with WfCommons - https://wfcommons.org",
+ "createdAt": "2021-09-06T03:43:31.762479",
+ "schemaVersion": "1.2",
+ "author": {
+ "name": "cc",
+ "email": "support@wfcommons.org"
+ },
+ "wms": {
+ "name": "Nextflow",
+ "version": "21.04.3",
+ "url": "https://www.nextflow.io"
+ },
+ "workflow": {
+ "executedAt": "20210906T034331+0000",
+ "makespan": 275,
+ "jobs": [
+ {
+ "name": "makebwaindex_mammoth_mt_krause.fasta",
+ "type": "compute",
+ "runtime": 172.182,
+ "command": {
+ "program": "makebwaindex",
+ "arguments": [
+ "bwa",
+ "index",
+ "Mammoth_MT_Krause.fasta",
+ "mkdir",
+ "BWAIndex",
+ "&&",
+ "mv",
+ "Mammoth_MT_Krause.fasta*",
+ "BWAIndex"
+ ]
+ },
+ "parents": [],
+ "children": [
+ "makeseqdict_mammoth_mt_krause.fasta"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000001",
+ "category": "makebwaindex",
+ "avgCPU": 5.8,
+ "bytesRead": 124,
+ "bytesWritten": 126,
+ "memory": 4248
+ },
+ {
+ "name": "makeseqdict_mammoth_mt_krause.fasta",
+ "type": "compute",
+ "runtime": 175.427,
+ "command": {
+ "program": "makeseqdict",
+ "arguments": [
+ "picard",
+ "-Xmx6144M",
+ "CreateSequenceDictionary",
+ "R=Mammoth_MT_Krause.fasta",
+ "O=\"Mammoth_MT_Krause.dict\""
+ ]
+ },
+ "parents": [
+ "makebwaindex_mammoth_mt_krause.fasta"
+ ],
+ "children": [
+ "makefastaindex_mammoth_mt_krause.fasta"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000003",
+ "category": "makeseqdict",
+ "avgCPU": 83.5,
+ "bytesRead": 22728,
+ "bytesWritten": 1300,
+ "memory": 104416
+ },
+ {
+ "name": "makefastaindex_mammoth_mt_krause.fasta",
+ "type": "compute",
+ "runtime": 170.797,
+ "command": {
+ "program": "makefastaindex",
+ "arguments": [
+ "samtools",
+ "faidx",
+ "Mammoth_MT_Krause.fasta"
+ ]
+ },
+ "parents": [
+ "makeseqdict_mammoth_mt_krause.fasta"
+ ],
+ "children": [
+ "output_documentation"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000002",
+ "category": "makefastaindex",
+ "avgCPU": 23.8,
+ "bytesRead": 66,
+ "bytesWritten": 4,
+ "memory": 6096
+ },
+ {
+ "name": "output_documentation",
+ "type": "compute",
+ "runtime": 173.479,
+ "command": {
+ "program": "output_documentation",
+ "arguments": [
+ "markdown_to_html.py",
+ "output.md",
+ "-o",
+ "results_description.html"
+ ]
+ },
+ "parents": [
+ "makefastaindex_mammoth_mt_krause.fasta"
+ ],
+ "children": [
+ "get_software_versions"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000005",
+ "category": "output_documentation",
+ "avgCPU": 84.0,
+ "bytesRead": 8222,
+ "bytesWritten": 15165,
+ "memory": 11488
+ },
+ {
+ "name": "get_software_versions",
+ "type": "compute",
+ "runtime": 183.445,
+ "command": {
+ "program": "get_software_versions",
+ "arguments": [
+ "echo",
+ "2.3.5",
+ "&>",
+ "v_pipeline.txt",
+ "echo",
+ "21.04.3",
+ "&>",
+ "v_nextflow.txt",
+ "fastqc",
+ "--version",
+ "&>",
+ "v_fastqc.txt",
+ "2>&1",
+ "||",
+ "true",
+ "AdapterRemoval",
+ "--version",
+ "&>",
+ "v_adapterremoval.txt",
+ "2>&1",
+ "||",
+ "true",
+ "fastp",
+ "--version",
+ "&>",
+ "v_fastp.txt",
+ "2>&1",
+ "||",
+ "true",
+ "bwa",
+ "&>",
+ "v_bwa.txt",
+ "2>&1",
+ "||",
+ "true",
+ "circulargenerator",
+ "--help",
+ "|",
+ "head",
+ "-n",
+ "1",
+ "&>",
+ "v_circulargenerator.txt",
+ "2>&1",
+ "||",
+ "true",
+ "samtools",
+ "--version",
+ "&>",
+ "v_samtools.txt",
+ "2>&1",
+ "||",
+ "true",
+ "dedup",
+ "-v",
+ "&>",
+ "v_dedup.txt",
+ "2>&1",
+ "||",
+ "true",
+ "##",
+ "bioconda",
+ "recipe",
+ "of",
+ "picard",
+ "is",
+ "incorrectly",
+ "set",
+ "up",
+ "and",
+ "extra",
+ "warning",
+ "made",
+ "with",
+ "stderr,",
+ "this",
+ "ugly",
+ "command",
+ "ensures",
+ "only",
+ "version",
+ "exported",
+ "(",
+ "exec",
+ "7>&1",
+ "picard",
+ "MarkDuplicates",
+ "--version",
+ "2>&1",
+ ">&7",
+ "|",
+ "grep",
+ "-v",
+ "/",
+ ">&2",
+ ")",
+ "2>",
+ "v_markduplicates.txt",
+ "||",
+ "true",
+ "qualimap",
+ "--version",
+ "&>",
+ "v_qualimap.txt",
+ "2>&1",
+ "||",
+ "true",
+ "preseq",
+ "&>",
+ "v_preseq.txt",
+ "2>&1",
+ "||",
+ "true",
+ "gatk",
+ "--version",
+ "2>&1",
+ "|",
+ "head",
+ "-n",
+ "1",
+ ">",
+ "v_gatk.txt",
+ "2>&1",
+ "||",
+ "true",
+ "gatk3",
+ "--version",
+ "2>&1",
+ ">",
+ "v_gatk3.txt",
+ "2>&1",
+ "||",
+ "true",
+ "freebayes",
+ "--version",
+ "&>",
+ "v_freebayes.txt",
+ "2>&1",
+ "||",
+ "true",
+ "bedtools",
+ "--version",
+ "&>",
+ "v_bedtools.txt",
+ "2>&1",
+ "||",
+ "true",
+ "damageprofiler",
+ "--version",
+ "&>",
+ "v_damageprofiler.txt",
+ "2>&1",
+ "||",
+ "true",
+ "bam",
+ "--version",
+ "&>",
+ "v_bamutil.txt",
+ "2>&1",
+ "||",
+ "true",
+ "pmdtools",
+ "--version",
+ "&>",
+ "v_pmdtools.txt",
+ "2>&1",
+ "||",
+ "true",
+ "angsd",
+ "-h",
+ "|&",
+ "head",
+ "-n",
+ "1",
+ "|",
+ "cut",
+ "-d",
+ "-f3-4",
+ "&>",
+ "v_angsd.txt",
+ "2>&1",
+ "||",
+ "true",
+ "multivcfanalyzer",
+ "--help",
+ "|",
+ "head",
+ "-n",
+ "1",
+ "&>",
+ "v_multivcfanalyzer.txt",
+ "2>&1",
+ "||",
+ "true",
+ "malt-run",
+ "--help",
+ "|&",
+ "tail",
+ "-n",
+ "3",
+ "|",
+ "head",
+ "-n",
+ "1",
+ "|",
+ "cut",
+ "-f",
+ "2",
+ "-d(",
+ "|",
+ "cut",
+ "-f",
+ "1",
+ "-d",
+ ",",
+ "&>",
+ "v_malt.txt",
+ "2>&1",
+ "||",
+ "true",
+ "MaltExtract",
+ "--help",
+ "|",
+ "head",
+ "-n",
+ "2",
+ "|",
+ "tail",
+ "-n",
+ "1",
+ "&>",
+ "v_maltextract.txt",
+ "2>&1",
+ "||",
+ "true",
+ "multiqc",
+ "--version",
+ "&>",
+ "v_multiqc.txt",
+ "2>&1",
+ "||",
+ "true",
+ "vcf2genome",
+ "-h",
+ "|&",
+ "head",
+ "-n",
+ "1",
+ "&>",
+ "v_vcf2genome.txt",
+ "||",
+ "true",
+ "mtnucratio",
+ "--help",
+ "&>",
+ "v_mtnucratiocalculator.txt",
+ "||",
+ "true",
+ "sexdeterrmine",
+ "--version",
+ "&>",
+ "v_sexdeterrmine.txt",
+ "||",
+ "true",
+ "kraken2",
+ "--version",
+ "|",
+ "head",
+ "-n",
+ "1",
+ "&>",
+ "v_kraken.txt",
+ "||",
+ "true",
+ "endorS.py",
+ "--version",
+ "&>",
+ "v_endorSpy.txt",
+ "||",
+ "true",
+ "pileupCaller",
+ "--version",
+ "&>",
+ "v_sequencetools.txt",
+ "2>&1",
+ "||",
+ "true",
+ "bowtie2",
+ "--version",
+ "|",
+ "grep",
+ "-a",
+ "bowtie2-.*",
+ "-fdebug",
+ ">",
+ "v_bowtie2.txt",
+ "||",
+ "true",
+ "eigenstrat_snp_coverage",
+ "--version",
+ "|",
+ "cut",
+ "-d",
+ "-f2",
+ ">v_eigenstrat_snp_coverage.txt",
+ "||",
+ "true",
+ "mapDamage",
+ "--version",
+ ">",
+ "v_mapdamage.txt",
+ "||",
+ "true",
+ "bbduk.sh",
+ "|",
+ "grep",
+ "Last",
+ "modified",
+ "|",
+ "cut",
+ "-d",
+ "-f",
+ "3-99",
+ ">",
+ "v_bbduk.txt",
+ "||",
+ "true",
+ "scrape_software_versions.py",
+ "&>",
+ "software_versions_mqc.yaml"
+ ]
+ },
+ "parents": [
+ "output_documentation"
+ ],
+ "children": [
+ "fastqc_jk2782_l1",
+ "fastqc_jk2802_l2"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000006",
+ "category": "get_software_versions",
+ "avgCPU": 147.8,
+ "bytesRead": 172760,
+ "bytesWritten": 1048,
+ "memory": 387324
+ },
+ {
+ "name": "fastqc_jk2782_l1",
+ "type": "compute",
+ "runtime": 175.205,
+ "command": {
+ "program": "fastqc",
+ "arguments": [
+ "fastqc",
+ "-t",
+ "2",
+ "-q",
+ "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz",
+ "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz",
+ "rename",
+ "s/_fastqc.zip$/_raw_fastqc.zip/",
+ "*_fastqc.zip",
+ "rename",
+ "s/_fastqc.html$/_raw_fastqc.html/",
+ "*_fastqc.html"
+ ]
+ },
+ "parents": [
+ "get_software_versions"
+ ],
+ "children": [
+ "adapter_removal_jk2782_l1",
+ "adapter_removal_jk2802_l2"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000007",
+ "category": "fastqc",
+ "avgCPU": 161.8,
+ "bytesRead": 35981,
+ "bytesWritten": 3967,
+ "memory": 270124
+ },
+ {
+ "name": "adapter_removal_jk2782_l1",
+ "type": "compute",
+ "runtime": 172.643,
+ "command": {
+ "program": "adapter_removal",
+ "arguments": [
+ "mkdir",
+ "-p",
+ "output",
+ "AdapterRemoval",
+ "--file1",
+ "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz",
+ "--file2",
+ "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz",
+ "--basename",
+ "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe",
+ "--gzip",
+ "--threads",
+ "2",
+ "--qualitymax",
+ "41",
+ "--collapse",
+ "--trimns",
+ "--trimqualities",
+ "--adapter1",
+ "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC",
+ "--adapter2",
+ "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA",
+ "--minlength",
+ "30",
+ "--minquality",
+ "20",
+ "--minadapteroverlap",
+ "1",
+ "cat",
+ "*.collapsed.gz",
+ "*.collapsed.truncated.gz",
+ "*.singleton.truncated.gz",
+ "*.pair1.truncated.gz",
+ "*.pair2.truncated.gz",
+ ">",
+ "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz",
+ "mv",
+ "*.settings",
+ "output/",
+ "##",
+ "Add",
+ "R_",
+ "and",
+ "L_",
+ "for",
+ "unmerged",
+ "reads",
+ "for",
+ "DeDup",
+ "compatibility",
+ "AdapterRemovalFixPrefix",
+ "-Xmx4g",
+ "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz",
+ "|",
+ "pigz",
+ "-p",
+ "1",
+ ">",
+ "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz"
+ ]
+ },
+ "parents": [
+ "fastqc_jk2782_l1",
+ "fastqc_jk2802_l2"
+ ],
+ "children": [
+ "fastqc_after_clipping_jk2782_l1",
+ "fastqc_after_clipping_jk2802_l2"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000008",
+ "category": "adapter_removal",
+ "avgCPU": 160.9,
+ "bytesRead": 17357,
+ "bytesWritten": 4405,
+ "memory": 79308
+ },
+ {
+ "name": "fastqc_jk2802_l2",
+ "type": "compute",
+ "runtime": 177.338,
+ "command": {
+ "program": "fastqc",
+ "arguments": [
+ "fastqc",
+ "-q",
+ "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz",
+ "rename",
+ "s/_fastqc.zip$/_raw_fastqc.zip/",
+ "*_fastqc.zip",
+ "rename",
+ "s/_fastqc.html$/_raw_fastqc.html/",
+ "*_fastqc.html"
+ ]
+ },
+ "parents": [
+ "get_software_versions"
+ ],
+ "children": [
+ "adapter_removal_jk2782_l1",
+ "adapter_removal_jk2802_l2"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000009",
+ "category": "fastqc",
+ "avgCPU": 120.1,
+ "bytesRead": 24457,
+ "bytesWritten": 2181,
+ "memory": 181060
+ },
+ {
+ "name": "adapter_removal_jk2802_l2",
+ "type": "compute",
+ "runtime": 174.313,
+ "command": {
+ "program": "adapter_removal",
+ "arguments": [
+ "mkdir",
+ "-p",
+ "output",
+ "AdapterRemoval",
+ "--file1",
+ "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz",
+ "--basename",
+ "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se",
+ "--gzip",
+ "--threads",
+ "2",
+ "--qualitymax",
+ "41",
+ "--trimns",
+ "--trimqualities",
+ "--adapter1",
+ "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC",
+ "--adapter2",
+ "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA",
+ "--minlength",
+ "30",
+ "--minquality",
+ "20",
+ "--minadapteroverlap",
+ "1",
+ "mv",
+ "*.settings",
+ "*.se.truncated.gz",
+ "output/"
+ ]
+ },
+ "parents": [
+ "fastqc_jk2782_l1",
+ "fastqc_jk2802_l2"
+ ],
+ "children": [
+ "fastqc_after_clipping_jk2782_l1",
+ "fastqc_after_clipping_jk2802_l2"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000010",
+ "category": "adapter_removal",
+ "avgCPU": 106.5,
+ "bytesRead": 683,
+ "bytesWritten": 897,
+ "memory": 12136
+ },
+ {
+ "name": "fastqc_after_clipping_jk2782_l1",
+ "type": "compute",
+ "runtime": 15.371,
+ "command": {
+ "program": "fastqc_after_clipping",
+ "arguments": [
+ "fastqc",
+ "-t",
+ "2",
+ "-q",
+ "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz"
+ ]
+ },
+ "parents": [
+ "adapter_removal_jk2782_l1",
+ "adapter_removal_jk2802_l2"
+ ],
+ "children": [
+ "bwa_jk2802",
+ "bwa_jk2782"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000013",
+ "category": "fastqc_after_clipping",
+ "avgCPU": 133.3,
+ "bytesRead": 23788,
+ "bytesWritten": 1998,
+ "memory": 215020
+ },
+ {
+ "name": "fastqc_after_clipping_jk2802_l2",
+ "type": "compute",
+ "runtime": 15.272,
+ "command": {
+ "program": "fastqc_after_clipping",
+ "arguments": [
+ "fastqc",
+ "-t",
+ "2",
+ "-q",
+ "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz"
+ ]
+ },
+ "parents": [
+ "adapter_removal_jk2782_l1",
+ "adapter_removal_jk2802_l2"
+ ],
+ "children": [
+ "bwa_jk2802",
+ "bwa_jk2782"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000014",
+ "category": "fastqc_after_clipping",
+ "avgCPU": 124.1,
+ "bytesRead": 23882,
+ "bytesWritten": 2143,
+ "memory": 213064
+ },
+ {
+ "name": "bwa_jk2802",
+ "type": "compute",
+ "runtime": 9.566,
+ "command": {
+ "program": "bwa",
+ "arguments": [
+ "bwa",
+ "aln",
+ "-t",
+ "2",
+ "BWAIndex/Mammoth_MT_Krause.fasta",
+ "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz",
+ "-n",
+ "0.04",
+ "-l",
+ "1024",
+ "-k",
+ "2",
+ "-o",
+ "1",
+ "-f",
+ "JK2802.sai",
+ "bwa",
+ "samse",
+ "-r",
+ "\"@RGtID:ILLUMINA-JK2802tSM:JK2802tPL:illuminatPU:ILLUMINA-JK2802-SE\"",
+ "BWAIndex/Mammoth_MT_Krause.fasta",
+ "JK2802.sai",
+ "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz",
+ "|",
+ "samtools",
+ "sort",
+ "-@",
+ "1",
+ "-O",
+ "bam",
+ "-",
+ ">",
+ "\"JK2802\"_\"SE\".mapped.bam",
+ "samtools",
+ "index",
+ "\"JK2802\"_\"SE\".mapped.bam"
+ ]
+ },
+ "parents": [
+ "fastqc_after_clipping_jk2782_l1",
+ "fastqc_after_clipping_jk2802_l2"
+ ],
+ "children": [
+ "samtools_flagstat_jk2782",
+ "samtools_flagstat_jk2802"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000016",
+ "category": "bwa",
+ "avgCPU": 15.7,
+ "bytesRead": 3774,
+ "bytesWritten": 3367,
+ "memory": 10628
+ },
+ {
+ "name": "bwa_jk2782",
+ "type": "compute",
+ "runtime": 9.652,
+ "command": {
+ "program": "bwa",
+ "arguments": [
+ "bwa",
+ "aln",
+ "-t",
+ "2",
+ "BWAIndex/Mammoth_MT_Krause.fasta",
+ "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz",
+ "-n",
+ "0.04",
+ "-l",
+ "1024",
+ "-k",
+ "2",
+ "-o",
+ "1",
+ "-f",
+ "JK2782.sai",
+ "bwa",
+ "samse",
+ "-r",
+ "\"@RGtID:ILLUMINA-JK2782tSM:JK2782tPL:illuminatPU:ILLUMINA-JK2782-PE\"",
+ "BWAIndex/Mammoth_MT_Krause.fasta",
+ "JK2782.sai",
+ "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz",
+ "|",
+ "samtools",
+ "sort",
+ "-@",
+ "1",
+ "-O",
+ "bam",
+ "-",
+ ">",
+ "\"JK2782\"_\"PE\".mapped.bam",
+ "samtools",
+ "index",
+ "\"JK2782\"_\"PE\".mapped.bam"
+ ]
+ },
+ "parents": [
+ "fastqc_after_clipping_jk2782_l1",
+ "fastqc_after_clipping_jk2802_l2"
+ ],
+ "children": [
+ "samtools_flagstat_jk2782",
+ "samtools_flagstat_jk2802"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000015",
+ "category": "bwa",
+ "avgCPU": 69.8,
+ "bytesRead": 3705,
+ "bytesWritten": 3355,
+ "memory": 12876
+ },
+ {
+ "name": "samtools_flagstat_jk2782",
+ "type": "compute",
+ "runtime": 13.011,
+ "command": {
+ "program": "samtools_flagstat",
+ "arguments": [
+ "samtools",
+ "flagstat",
+ "JK2782_PE.mapped.bam",
+ ">",
+ "JK2782_flagstat.stats"
+ ]
+ },
+ "parents": [
+ "bwa_jk2802",
+ "bwa_jk2782"
+ ],
+ "children": [
+ "markduplicates_jk2782",
+ "markduplicates_jk2802"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000026",
+ "category": "samtools_flagstat",
+ "avgCPU": 30.1,
+ "bytesRead": 478,
+ "bytesWritten": 5,
+ "memory": 6468
+ },
+ {
+ "name": "samtools_flagstat_jk2802",
+ "type": "compute",
+ "runtime": 13.129,
+ "command": {
+ "program": "samtools_flagstat",
+ "arguments": [
+ "samtools",
+ "flagstat",
+ "JK2802_SE.mapped.bam",
+ ">",
+ "JK2802_flagstat.stats"
+ ]
+ },
+ "parents": [
+ "bwa_jk2802",
+ "bwa_jk2782"
+ ],
+ "children": [
+ "markduplicates_jk2782",
+ "markduplicates_jk2802"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000024",
+ "category": "samtools_flagstat",
+ "avgCPU": 118.5,
+ "bytesRead": 551,
+ "bytesWritten": 5
+ },
+ {
+ "name": "markduplicates_jk2782",
+ "type": "compute",
+ "runtime": 22.655,
+ "command": {
+ "program": "markduplicates",
+ "arguments": [
+ "mv",
+ "JK2782_PE.mapped.bam",
+ "JK2782.bam",
+ "picard",
+ "-Xmx4096M",
+ "MarkDuplicates",
+ "INPUT=JK2782.bam",
+ "OUTPUT=JK2782_rmdup.bam",
+ "REMOVE_DUPLICATES=TRUE",
+ "AS=TRUE",
+ "METRICS_FILE=\"JK2782_rmdup.metrics\"",
+ "VALIDATION_STRINGENCY=SILENT",
+ "samtools",
+ "index",
+ "JK2782_rmdup.bam"
+ ]
+ },
+ "parents": [
+ "samtools_flagstat_jk2782",
+ "samtools_flagstat_jk2802"
+ ],
+ "children": [
+ "preseq_jk2782",
+ "preseq_jk2802"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000021",
+ "category": "markduplicates",
+ "avgCPU": 173.6,
+ "bytesRead": 24055,
+ "bytesWritten": 2319,
+ "memory": 1400048
+ },
+ {
+ "name": "markduplicates_jk2802",
+ "type": "compute",
+ "runtime": 21.545,
+ "command": {
+ "program": "markduplicates",
+ "arguments": [
+ "mv",
+ "JK2802_SE.mapped.bam",
+ "JK2802.bam",
+ "picard",
+ "-Xmx4096M",
+ "MarkDuplicates",
+ "INPUT=JK2802.bam",
+ "OUTPUT=JK2802_rmdup.bam",
+ "REMOVE_DUPLICATES=TRUE",
+ "AS=TRUE",
+ "METRICS_FILE=\"JK2802_rmdup.metrics\"",
+ "VALIDATION_STRINGENCY=SILENT",
+ "samtools",
+ "index",
+ "JK2802_rmdup.bam"
+ ]
+ },
+ "parents": [
+ "samtools_flagstat_jk2782",
+ "samtools_flagstat_jk2802"
+ ],
+ "children": [
+ "preseq_jk2782",
+ "preseq_jk2802"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000020",
+ "category": "markduplicates",
+ "avgCPU": 182.6,
+ "bytesRead": 24242,
+ "bytesWritten": 2466,
+ "memory": 1404624
+ },
+ {
+ "name": "preseq_jk2782",
+ "type": "compute",
+ "runtime": 12.299,
+ "command": {
+ "program": "preseq",
+ "arguments": [
+ "preseq",
+ "c_curve",
+ "-s",
+ "1000",
+ "-o",
+ "JK2782_PE.mapped.ccurve",
+ "-B",
+ "JK2782_PE.mapped.bam"
+ ]
+ },
+ "parents": [
+ "markduplicates_jk2782",
+ "markduplicates_jk2802"
+ ],
+ "children": [
+ "endorspy_jk2782",
+ "endorspy_jk2802"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000030",
+ "category": "preseq",
+ "avgCPU": 81.9,
+ "bytesRead": 473,
+ "bytesWritten": 4,
+ "memory": 12032
+ },
+ {
+ "name": "preseq_jk2802",
+ "type": "compute",
+ "runtime": 10.188,
+ "command": {
+ "program": "preseq",
+ "arguments": [
+ "preseq",
+ "c_curve",
+ "-s",
+ "1000",
+ "-o",
+ "JK2802_SE.mapped.ccurve",
+ "-B",
+ "JK2802_SE.mapped.bam"
+ ]
+ },
+ "parents": [
+ "markduplicates_jk2782",
+ "markduplicates_jk2802"
+ ],
+ "children": [
+ "endorspy_jk2782",
+ "endorspy_jk2802"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000027",
+ "category": "preseq",
+ "avgCPU": 77.6,
+ "bytesRead": 548,
+ "bytesWritten": 4,
+ "memory": 11972
+ },
+ {
+ "name": "endorspy_jk2782",
+ "type": "compute",
+ "runtime": 7.537,
+ "command": {
+ "program": "endorspy",
+ "arguments": [
+ "endorS.py",
+ "-o",
+ "json",
+ "-n",
+ "JK2782",
+ "JK2782_flagstat.stats"
+ ]
+ },
+ "parents": [
+ "preseq_jk2782",
+ "preseq_jk2802"
+ ],
+ "children": [
+ "damageprofiler_jk2802",
+ "damageprofiler_jk2782"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000031",
+ "category": "endorspy",
+ "avgCPU": 44.7,
+ "bytesRead": 623,
+ "bytesWritten": 4,
+ "memory": 12264
+ },
+ {
+ "name": "endorspy_jk2802",
+ "type": "compute",
+ "runtime": 8.0,
+ "command": {
+ "program": "endorspy",
+ "arguments": [
+ "endorS.py",
+ "-o",
+ "json",
+ "-n",
+ "JK2802",
+ "JK2802_flagstat.stats"
+ ]
+ },
+ "parents": [
+ "preseq_jk2782",
+ "preseq_jk2802"
+ ],
+ "children": [
+ "damageprofiler_jk2802",
+ "damageprofiler_jk2782"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000032",
+ "category": "endorspy",
+ "avgCPU": 54.0,
+ "bytesRead": 623,
+ "bytesWritten": 4,
+ "memory": 12224
+ },
+ {
+ "name": "damageprofiler_jk2802",
+ "type": "compute",
+ "runtime": 18.596,
+ "command": {
+ "program": "damageprofiler",
+ "arguments": [
+ "damageprofiler",
+ "-Xmx4g",
+ "-i",
+ "JK2802_rmdup.bam",
+ "-r",
+ "Mammoth_MT_Krause.fasta",
+ "-l",
+ "100",
+ "-t",
+ "15",
+ "-o",
+ ".",
+ "-yaxis_damageplot",
+ "0.30"
+ ]
+ },
+ "parents": [
+ "endorspy_jk2782",
+ "endorspy_jk2802"
+ ],
+ "children": [
+ "qualimap_jk2802",
+ "qualimap_jk2782"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000033",
+ "category": "damageprofiler",
+ "avgCPU": 88.6,
+ "bytesRead": 25744,
+ "bytesWritten": 391,
+ "memory": 242940
+ },
+ {
+ "name": "damageprofiler_jk2782",
+ "type": "compute",
+ "runtime": 16.736,
+ "command": {
+ "program": "damageprofiler",
+ "arguments": [
+ "damageprofiler",
+ "-Xmx4g",
+ "-i",
+ "JK2782_rmdup.bam",
+ "-r",
+ "Mammoth_MT_Krause.fasta",
+ "-l",
+ "100",
+ "-t",
+ "15",
+ "-o",
+ ".",
+ "-yaxis_damageplot",
+ "0.30"
+ ]
+ },
+ "parents": [
+ "endorspy_jk2782",
+ "endorspy_jk2802"
+ ],
+ "children": [
+ "qualimap_jk2802",
+ "qualimap_jk2782"
+ ],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000036",
+ "category": "damageprofiler",
+ "avgCPU": 88.3,
+ "bytesRead": 25661,
+ "bytesWritten": 327,
+ "memory": 198276
+ },
+ {
+ "name": "qualimap_jk2802",
+ "type": "compute",
+ "runtime": 15.368,
+ "command": {
+ "program": "qualimap",
+ "arguments": [
+ "qualimap",
+ "bamqc",
+ "-bam",
+ "JK2802_rmdup.bam",
+ "-nt",
+ "2",
+ "-outdir",
+ ".",
+ "-outformat",
+ "\"HTML\"",
+ "--java-mem-size=4G"
+ ]
+ },
+ "parents": [
+ "damageprofiler_jk2802",
+ "damageprofiler_jk2782"
+ ],
+ "children": [
+ "multiqc_1"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000053",
+ "category": "qualimap",
+ "avgCPU": 177.7,
+ "bytesRead": 35038,
+ "bytesWritten": 1712,
+ "memory": 209440
+ },
+ {
+ "name": "qualimap_jk2782",
+ "type": "compute",
+ "runtime": 14.223,
+ "command": {
+ "program": "qualimap",
+ "arguments": [
+ "qualimap",
+ "bamqc",
+ "-bam",
+ "JK2782_rmdup.bam",
+ "-nt",
+ "2",
+ "-outdir",
+ ".",
+ "-outformat",
+ "\"HTML\"",
+ "--java-mem-size=4G"
+ ]
+ },
+ "parents": [
+ "damageprofiler_jk2802",
+ "damageprofiler_jk2782"
+ ],
+ "children": [
+ "multiqc_1"
+ ],
+ "files": [],
+ "cores": 2.0,
+ "id": "ID000054",
+ "category": "qualimap",
+ "avgCPU": 181.9,
+ "bytesRead": 34954,
+ "bytesWritten": 1937,
+ "memory": 232196
+ },
+ {
+ "name": "multiqc_1",
+ "type": "compute",
+ "runtime": 46.376,
+ "command": {
+ "program": "multiqc",
+ "arguments": [
+ "multiqc",
+ "-f",
+ "multiqc_config.yaml",
+ "."
+ ]
+ },
+ "parents": [
+ "qualimap_jk2802",
+ "qualimap_jk2782"
+ ],
+ "children": [],
+ "files": [],
+ "cores": 1.0,
+ "id": "ID000056",
+ "category": "multiqc",
+ "avgCPU": 93.0,
+ "bytesRead": 1215169,
+ "bytesWritten": 22599,
+ "memory": 139496
+ }
+ ]
+ }
+}