From fff89d25bd3c7b874e68261d21695c473c30ed7d Mon Sep 17 00:00:00 2001 From: Dante Niewenhuis Date: Tue, 16 Apr 2024 09:29:53 +0200 Subject: =?UTF-8?q?Revamped=20the=20trace=20system.=20All=20TraceFormat=20?= =?UTF-8?q?files=20are=20now=20in=20the=20api=20m=E2=80=A6=20(#216)?= MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit * Revamped the trace system. All TraceFormat files are now in the api module. This fixes some problems with not being able to use types of traces * applied spotless --- .../formats/azure/AzureResourceStateTableReader.kt | 219 + .../formats/azure/AzureResourceTableReader.kt | 246 + .../opendc/trace/formats/azure/AzureTraceFormat.kt | 147 + .../BitbrainsExResourceStateTableReader.kt | 292 + .../formats/bitbrains/BitbrainsExTraceFormat.kt | 135 + .../bitbrains/BitbrainsResourceStateTableReader.kt | 365 + .../bitbrains/BitbrainsResourceTableReader.kt | 175 + .../formats/bitbrains/BitbrainsTraceFormat.kt | 159 + .../opendc/trace/formats/gwf/GwfTaskTableReader.kt | 286 + .../org/opendc/trace/formats/gwf/GwfTraceFormat.kt | 104 + .../opendc/OdcVmInterferenceJsonTableReader.kt | 225 + .../opendc/OdcVmInterferenceJsonTableWriter.kt | 192 + .../opendc/OdcVmResourceStateTableReader.kt | 166 + .../opendc/OdcVmResourceStateTableWriter.kt | 209 + .../formats/opendc/OdcVmResourceTableReader.kt | 168 + .../formats/opendc/OdcVmResourceTableWriter.kt | 197 + .../trace/formats/opendc/OdcVmTraceFormat.kt | 190 + .../trace/formats/opendc/parquet/Resource.kt | 37 + .../formats/opendc/parquet/ResourceReadSupport.kt | 159 + .../opendc/parquet/ResourceRecordMaterializer.kt | 127 + .../trace/formats/opendc/parquet/ResourceState.kt | 34 + .../opendc/parquet/ResourceStateReadSupport.kt | 149 + .../parquet/ResourceStateRecordMaterializer.kt | 114 + .../opendc/parquet/ResourceStateWriteSupport.kt | 112 + .../formats/opendc/parquet/ResourceWriteSupport.kt | 121 + .../opendc/trace/formats/swf/SwfTaskTableReader.kt | 236 + .../org/opendc/trace/formats/swf/SwfTraceFormat.kt | 100 + .../formats/wfformat/WfFormatTaskTableReader.kt | 314 + .../trace/formats/wfformat/WfFormatTraceFormat.kt | 95 + .../opendc/trace/formats/wtf/WtfTaskTableReader.kt | 187 + .../org/opendc/trace/formats/wtf/WtfTraceFormat.kt | 102 + .../org/opendc/trace/formats/wtf/parquet/Task.kt | 42 + .../trace/formats/wtf/parquet/TaskReadSupport.kt | 148 + .../formats/wtf/parquet/TaskRecordMaterializer.kt | 188 + .../kotlin/org/opendc/trace/spi/TraceFormat.kt | 29 +- .../kotlin/formats/azure/AzureTraceFormatTest.kt | 132 + .../bitbrains/BitbrainsExTraceFormatTest.kt | 97 + .../formats/bitbrains/BitbrainsTraceFormatTest.kt | 129 + .../test/kotlin/formats/gwf/GwfTraceFormatTest.kt | 123 + .../kotlin/formats/opendc/OdcVmTraceFormatTest.kt | 348 + .../test/kotlin/formats/swf/SwfTraceFormatTest.kt | 101 + .../wfformat/WfFormatTaskTableReaderTest.kt | 361 + .../formats/wfformat/WfFormatTraceFormatTest.kt | 129 + .../test/kotlin/formats/wtf/TableReaderTestKit.kt | 190 + .../test/kotlin/formats/wtf/TableWriterTestKit.kt | 131 + .../test/kotlin/formats/wtf/WtfTraceFormatTest.kt | 141 + .../vm_cpu_readings-file-1-of-125.csv.gz | Bin 0 -> 6905 bytes .../resources/azure/trace/vmtable/vmtable.csv.gz | Bin 0 -> 1423 bytes .../src/test/resources/bitbrains/bitbrains.csv | 8620 ++++++++++++++++++++ .../src/test/resources/bitbrains/vm.txt | 2 + .../src/test/resources/gwf/trace.gwf | 71 + .../test/resources/opendc/trace-v2.0/meta.parquet | Bin 0 -> 1582 bytes .../test/resources/opendc/trace-v2.0/trace.parquet | Bin 0 -> 83524 bytes .../opendc/trace-v2.1/interference-model.json | 20 + .../test/resources/opendc/trace-v2.1/meta.parquet | Bin 0 -> 1679 bytes .../test/resources/opendc/trace-v2.1/trace.parquet | Bin 0 -> 65174 bytes .../src/test/resources/swf/trace.swf | 6 + .../src/test/resources/wfformat/trace.json | 1342 +++ .../wtf/shell/tasks/schema-1.0/part.0.parquet | Bin 0 -> 259381 bytes .../wtf/shell/workflows/schema-1.0/part.0.parquet | Bin 0 -> 63858 bytes .../workload/schema-1.0/generic_information.json | 1 + .../wtf/wtf-trace/tasks/schema-1.0/part.0.parquet | Bin 0 -> 87475 bytes 62 files changed, 17711 insertions(+), 2 deletions(-) create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureResourceStateTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureResourceTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureTraceFormat.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsExResourceStateTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsExTraceFormat.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsResourceStateTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsResourceTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsTraceFormat.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/gwf/GwfTaskTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/gwf/GwfTraceFormat.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmInterferenceJsonTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmInterferenceJsonTableWriter.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceStateTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceStateTableWriter.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceTableWriter.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmTraceFormat.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/Resource.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceReadSupport.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceRecordMaterializer.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceState.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateReadSupport.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateRecordMaterializer.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateWriteSupport.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceWriteSupport.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/swf/SwfTaskTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/swf/SwfTraceFormat.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wfformat/WfFormatTaskTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wfformat/WfFormatTraceFormat.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/WtfTaskTableReader.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/WtfTraceFormat.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/Task.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/TaskReadSupport.kt create mode 100644 opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/TaskRecordMaterializer.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/azure/AzureTraceFormatTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/bitbrains/BitbrainsExTraceFormatTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/bitbrains/BitbrainsTraceFormatTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/gwf/GwfTraceFormatTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/opendc/OdcVmTraceFormatTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/swf/SwfTraceFormatTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/wfformat/WfFormatTaskTableReaderTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/wfformat/WfFormatTraceFormatTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/TableReaderTestKit.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/TableWriterTestKit.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/WtfTraceFormatTest.kt create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/azure/trace/vm_cpu_readings/vm_cpu_readings-file-1-of-125.csv.gz create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/azure/trace/vmtable/vmtable.csv.gz create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/bitbrains/bitbrains.csv create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/bitbrains/vm.txt create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/gwf/trace.gwf create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.0/meta.parquet create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.0/trace.parquet create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/interference-model.json create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/meta.parquet create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/trace.parquet create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/swf/trace.swf create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/wfformat/trace.json create mode 100755 opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/tasks/schema-1.0/part.0.parquet create mode 100755 opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/workflows/schema-1.0/part.0.parquet create mode 100755 opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/workload/schema-1.0/generic_information.json create mode 100644 opendc-trace/opendc-trace-api/src/test/resources/wtf/wtf-trace/tasks/schema-1.0/part.0.parquet (limited to 'opendc-trace/opendc-trace-api/src') diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureResourceStateTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureResourceStateTableReader.kt new file mode 100644 index 00000000..bcf6ff52 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureResourceStateTableReader.kt @@ -0,0 +1,219 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.azure + +import com.fasterxml.jackson.core.JsonToken +import com.fasterxml.jackson.dataformat.csv.CsvParser +import com.fasterxml.jackson.dataformat.csv.CsvSchema +import org.opendc.trace.TableReader +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceStateCpuUsagePct +import org.opendc.trace.conv.resourceStateTimestamp +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] for the Azure v1 VM resource state table. + */ +internal class AzureResourceStateTableReader(private val parser: CsvParser) : TableReader { + /** + * A flag to indicate whether a single row has been read already. + */ + private var isStarted = false + + init { + parser.schema = schema + } + + override fun nextRow(): Boolean { + if (!isStarted) { + isStarted = true + } + + reset() + + if (!nextStart()) { + return false + } + + while (true) { + val token = parser.nextValue() + + if (token == null || token == JsonToken.END_OBJECT) { + break + } + + when (parser.currentName) { + "timestamp" -> timestamp = Instant.ofEpochSecond(parser.longValue) + "vm id" -> id = parser.text + "CPU avg cpu" -> cpuUsagePct = (parser.doubleValue / 100.0) // Convert from % to [0, 1] + } + } + + return true + } + + private val colID = 0 + private val colTimestamp = 1 + private val colCpuUsagePct = 2 + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + resourceStateTimestamp -> colTimestamp + resourceStateCpuUsagePct -> colCpuUsagePct + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0..colCpuUsagePct) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + throw IllegalArgumentException("Invalid column") + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + checkActive() + return when (index) { + colCpuUsagePct -> cpuUsagePct + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getString(index: Int): String? { + checkActive() + return when (index) { + colID -> id + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant? { + checkActive() + return when (index) { + colTimestamp -> timestamp + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getDuration(index: Int): Duration? { + throw IllegalArgumentException("Invalid column") + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + parser.close() + } + + /** + * Helper method to check if the reader is active. + */ + private fun checkActive() { + check(isStarted && !parser.isClosed) { "No active row. Did you call nextRow()?" } + } + + /** + * Advance the parser until the next object start. + */ + private fun nextStart(): Boolean { + var token = parser.nextValue() + + while (token != null && token != JsonToken.START_OBJECT) { + token = parser.nextValue() + } + + return token != null + } + + /** + * State fields of the reader. + */ + private var id: String? = null + private var timestamp: Instant? = null + private var cpuUsagePct = Double.NaN + + /** + * Reset the state. + */ + private fun reset() { + id = null + timestamp = null + cpuUsagePct = Double.NaN + } + + companion object { + /** + * The [CsvSchema] that is used to parse the trace. + */ + private val schema = + CsvSchema.builder() + .addColumn("timestamp", CsvSchema.ColumnType.NUMBER) + .addColumn("vm id", CsvSchema.ColumnType.STRING) + .addColumn("CPU min cpu", CsvSchema.ColumnType.NUMBER) + .addColumn("CPU max cpu", CsvSchema.ColumnType.NUMBER) + .addColumn("CPU avg cpu", CsvSchema.ColumnType.NUMBER) + .setAllowComments(true) + .build() + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureResourceTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureResourceTableReader.kt new file mode 100644 index 00000000..d86a0466 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureResourceTableReader.kt @@ -0,0 +1,246 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.azure + +import com.fasterxml.jackson.core.JsonToken +import com.fasterxml.jackson.dataformat.csv.CsvParser +import com.fasterxml.jackson.dataformat.csv.CsvSchema +import org.opendc.trace.TableReader +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStartTime +import org.opendc.trace.conv.resourceStopTime +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] for the Azure v1 VM resources table. + */ +internal class AzureResourceTableReader(private val parser: CsvParser) : TableReader { + /** + * A flag to indicate whether a single row has been read already. + */ + private var isStarted = false + + init { + parser.schema = schema + } + + override fun nextRow(): Boolean { + if (!isStarted) { + isStarted = true + } + + reset() + + if (!nextStart()) { + return false + } + + while (true) { + val token = parser.nextValue() + + if (token == null || token == JsonToken.END_OBJECT) { + break + } + + when (parser.currentName) { + "vm id" -> id = parser.text + "timestamp vm created" -> startTime = Instant.ofEpochSecond(parser.longValue) + "timestamp vm deleted" -> stopTime = Instant.ofEpochSecond(parser.longValue) + "vm virtual core count" -> cpuCores = parser.intValue + "vm memory" -> memCapacity = parser.doubleValue * 1e6 // GB to KB + } + } + + return true + } + + private val colID = 0 + private val colStartTime = 1 + private val colStopTime = 2 + private val colCpuCount = 3 + private val colMemCapacity = 4 + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + resourceStartTime -> colStartTime + resourceStopTime -> colStopTime + resourceCpuCount -> colCpuCount + resourceMemCapacity -> colMemCapacity + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0..colMemCapacity) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + checkActive() + return when (index) { + colCpuCount -> cpuCores + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + checkActive() + return when (index) { + colCpuCount -> cpuCores.toLong() + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + checkActive() + return when (index) { + colMemCapacity -> memCapacity + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getString(index: Int): String? { + checkActive() + return when (index) { + colID -> id + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant? { + checkActive() + return when (index) { + colStartTime -> startTime + colStopTime -> stopTime + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getDuration(index: Int): Duration? { + throw IllegalArgumentException("Invalid column") + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + throw IllegalArgumentException("Invalid column") + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + parser.close() + } + + /** + * Helper method to check if the reader is active. + */ + private fun checkActive() { + check(isStarted && !parser.isClosed) { "No active row. Did you call nextRow()?" } + } + + /** + * Advance the parser until the next object start. + */ + private fun nextStart(): Boolean { + var token = parser.nextValue() + + while (token != null && token != JsonToken.START_OBJECT) { + token = parser.nextValue() + } + + return token != null + } + + /** + * State fields of the reader. + */ + private var id: String? = null + private var startTime: Instant? = null + private var stopTime: Instant? = null + private var cpuCores = -1 + private var memCapacity = Double.NaN + + /** + * Reset the state. + */ + private fun reset() { + id = null + startTime = null + stopTime = null + cpuCores = -1 + memCapacity = Double.NaN + } + + companion object { + /** + * The [CsvSchema] that is used to parse the trace. + */ + private val schema = + CsvSchema.builder() + .addColumn("vm id", CsvSchema.ColumnType.NUMBER) + .addColumn("subscription id", CsvSchema.ColumnType.STRING) + .addColumn("deployment id", CsvSchema.ColumnType.NUMBER) + .addColumn("timestamp vm created", CsvSchema.ColumnType.NUMBER) + .addColumn("timestamp vm deleted", CsvSchema.ColumnType.NUMBER) + .addColumn("max cpu", CsvSchema.ColumnType.NUMBER) + .addColumn("avg cpu", CsvSchema.ColumnType.NUMBER) + .addColumn("p95 cpu", CsvSchema.ColumnType.NUMBER) + .addColumn("vm category", CsvSchema.ColumnType.NUMBER) + .addColumn("vm virtual core count", CsvSchema.ColumnType.NUMBER) + .addColumn("vm memory", CsvSchema.ColumnType.NUMBER) + .setAllowComments(true) + .build() + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureTraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureTraceFormat.kt new file mode 100644 index 00000000..a75da9d9 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/azure/AzureTraceFormat.kt @@ -0,0 +1,147 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.azure + +import com.fasterxml.jackson.dataformat.csv.CsvFactory +import com.fasterxml.jackson.dataformat.csv.CsvParser +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.TABLE_RESOURCES +import org.opendc.trace.conv.TABLE_RESOURCE_STATES +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStartTime +import org.opendc.trace.conv.resourceStateCpuUsagePct +import org.opendc.trace.conv.resourceStateTimestamp +import org.opendc.trace.conv.resourceStopTime +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import org.opendc.trace.util.CompositeTableReader +import java.nio.file.Files +import java.nio.file.Path +import java.util.stream.Collectors +import java.util.zip.GZIPInputStream +import kotlin.io.path.inputStream +import kotlin.io.path.name + +/** + * A format implementation for the Azure v1 format. + */ +public class AzureTraceFormat : TraceFormat { + /** + * The name of this trace format. + */ + override val name: String = "azure" + + /** + * The [CsvFactory] used to create the parser. + */ + private val factory = + CsvFactory() + .enable(CsvParser.Feature.ALLOW_COMMENTS) + .enable(CsvParser.Feature.TRIM_SPACES) + + override fun create(path: Path) { + throw UnsupportedOperationException("Writing not supported for this format") + } + + override fun getTables(path: Path): List = listOf(TABLE_RESOURCES, TABLE_RESOURCE_STATES) + + override fun getDetails( + path: Path, + table: String, + ): TableDetails { + return when (table) { + TABLE_RESOURCES -> + TableDetails( + listOf( + TableColumn(resourceID, TableColumnType.String), + TableColumn(resourceStartTime, TableColumnType.Instant), + TableColumn(resourceStopTime, TableColumnType.Instant), + TableColumn(resourceCpuCount, TableColumnType.Int), + TableColumn(resourceMemCapacity, TableColumnType.Double), + ), + ) + TABLE_RESOURCE_STATES -> + TableDetails( + listOf( + TableColumn(resourceID, TableColumnType.String), + TableColumn(resourceStateTimestamp, TableColumnType.Instant), + TableColumn(resourceStateCpuUsagePct, TableColumnType.Double), + ), + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader( + path: Path, + table: String, + projection: List?, + ): TableReader { + return when (table) { + TABLE_RESOURCES -> { + val stream = GZIPInputStream(path.resolve("vmtable/vmtable.csv.gz").inputStream()) + AzureResourceTableReader(factory.createParser(stream)) + } + TABLE_RESOURCE_STATES -> newResourceStateReader(path) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter( + path: Path, + table: String, + ): TableWriter { + throw UnsupportedOperationException("Writing not supported for this format") + } + + /** + * Construct a [TableReader] for reading over all VM CPU readings. + */ + private fun newResourceStateReader(path: Path): TableReader { + val partitions = + Files.walk(path.resolve("vm_cpu_readings"), 1) + .filter { !Files.isDirectory(it) && it.name.endsWith(".csv.gz") } + .collect(Collectors.toMap({ it.name.removeSuffix(".csv.gz") }, { it })) + .toSortedMap() + val it = partitions.iterator() + + return object : CompositeTableReader() { + override fun nextReader(): TableReader? { + return if (it.hasNext()) { + val (_, partPath) = it.next() + val stream = GZIPInputStream(partPath.inputStream()) + return AzureResourceStateTableReader(factory.createParser(stream)) + } else { + null + } + } + + override fun toString(): String = "AzureCompositeTableReader" + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsExResourceStateTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsExResourceStateTableReader.kt new file mode 100644 index 00000000..8387d1ed --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsExResourceStateTableReader.kt @@ -0,0 +1,292 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.bitbrains + +import org.opendc.trace.TableReader +import org.opendc.trace.conv.resourceClusterID +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStateCpuDemand +import org.opendc.trace.conv.resourceStateCpuReadyPct +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateCpuUsagePct +import org.opendc.trace.conv.resourceStateDiskRead +import org.opendc.trace.conv.resourceStateDiskWrite +import org.opendc.trace.conv.resourceStateTimestamp +import java.io.BufferedReader +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] for the Bitbrains resource state table. + */ +internal class BitbrainsExResourceStateTableReader(private val reader: BufferedReader) : TableReader { + private var state = State.Pending + + override fun nextRow(): Boolean { + val state = state + if (state == State.Closed) { + return false + } else if (state == State.Pending) { + this.state = State.Active + } + + reset() + + var line: String? + var num = 0 + + while (true) { + line = reader.readLine() + + if (line == null) { + this.state = State.Closed + return false + } + + num++ + + if (line[0] == '#' || line.isBlank()) { + // Ignore empty lines or comments + continue + } + + break + } + + line = line!!.trim() + + val length = line.length + var col = 0 + var start: Int + var end = 0 + + while (end < length) { + // Trim all whitespace before the field + start = end + while (start < length && line[start].isWhitespace()) { + start++ + } + + end = line.indexOf(' ', start) + + if (end < 0) { + end = length + } + + val field = line.subSequence(start, end) as String + when (col++) { + colTimestamp -> timestamp = Instant.ofEpochSecond(field.toLong(10)) + colCpuUsage -> cpuUsage = field.toDouble() + colCpuDemand -> cpuDemand = field.toDouble() + colDiskRead -> diskRead = field.toDouble() + colDiskWrite -> diskWrite = field.toDouble() + colClusterID -> cluster = field.trim() + colNcpus -> cpuCores = field.toInt(10) + colCpuReadyPct -> cpuReadyPct = field.toDouble() + colPoweredOn -> poweredOn = field.toInt(10) == 1 + colCpuCapacity -> cpuCapacity = field.toDouble() + colID -> id = field.trim() + colMemCapacity -> memCapacity = field.toDouble() * 1000 // Convert from MB to KB + } + } + + return true + } + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + resourceClusterID -> colClusterID + resourceStateTimestamp -> colTimestamp + resourceCpuCount -> colNcpus + resourceCpuCapacity -> colCpuCapacity + resourceStateCpuUsage -> colCpuUsage + resourceStateCpuUsagePct -> colCpuUsagePct + resourceStateCpuDemand -> colCpuDemand + resourceStateCpuReadyPct -> colCpuReadyPct + resourceMemCapacity -> colMemCapacity + resourceStateDiskRead -> colDiskRead + resourceStateDiskWrite -> colDiskWrite + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0 until colMax) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + check(state == State.Active) { "No active row" } + return when (index) { + colPoweredOn -> poweredOn + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getInt(index: Int): Int { + check(state == State.Active) { "No active row" } + return when (index) { + colNcpus -> cpuCores + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + check(state == State.Active) { "No active row" } + return when (index) { + colCpuCapacity -> cpuCapacity + colCpuUsage -> cpuUsage + colCpuUsagePct -> cpuUsage / cpuCapacity + colCpuReadyPct -> cpuReadyPct + colCpuDemand -> cpuDemand + colMemCapacity -> memCapacity + colDiskRead -> diskRead + colDiskWrite -> diskWrite + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getString(index: Int): String? { + check(state == State.Active) { "No active row" } + return when (index) { + colID -> id + colClusterID -> cluster + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant? { + check(state == State.Active) { "No active row" } + return when (index) { + colTimestamp -> timestamp + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getDuration(index: Int): Duration? { + throw IllegalArgumentException("Invalid column") + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + throw IllegalArgumentException("Invalid column") + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + reader.close() + reset() + state = State.Closed + } + + /** + * State fields of the reader. + */ + private var id: String? = null + private var cluster: String? = null + private var timestamp: Instant? = null + private var cpuCores = -1 + private var cpuCapacity = Double.NaN + private var cpuUsage = Double.NaN + private var cpuDemand = Double.NaN + private var cpuReadyPct = Double.NaN + private var memCapacity = Double.NaN + private var diskRead = Double.NaN + private var diskWrite = Double.NaN + private var poweredOn: Boolean = false + + /** + * Reset the state of the reader. + */ + private fun reset() { + id = null + timestamp = null + cluster = null + cpuCores = -1 + cpuCapacity = Double.NaN + cpuUsage = Double.NaN + cpuDemand = Double.NaN + cpuReadyPct = Double.NaN + memCapacity = Double.NaN + diskRead = Double.NaN + diskWrite = Double.NaN + poweredOn = false + } + + /** + * Default column indices for the extended Bitbrains format. + */ + private val colTimestamp = 0 + private val colCpuUsage = 1 + private val colCpuDemand = 2 + private val colDiskRead = 4 + private val colDiskWrite = 6 + private val colClusterID = 10 + private val colNcpus = 12 + private val colCpuReadyPct = 13 + private val colPoweredOn = 14 + private val colCpuCapacity = 18 + private val colID = 19 + private val colMemCapacity = 20 + private val colCpuUsagePct = 21 + private val colMax = colCpuUsagePct + 1 + + private enum class State { + Pending, + Active, + Closed, + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsExTraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsExTraceFormat.kt new file mode 100644 index 00000000..6115953f --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsExTraceFormat.kt @@ -0,0 +1,135 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.bitbrains + +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.TABLE_RESOURCE_STATES +import org.opendc.trace.conv.resourceClusterID +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStateCpuDemand +import org.opendc.trace.conv.resourceStateCpuReadyPct +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateCpuUsagePct +import org.opendc.trace.conv.resourceStateDiskRead +import org.opendc.trace.conv.resourceStateDiskWrite +import org.opendc.trace.conv.resourceStateTimestamp +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import org.opendc.trace.util.CompositeTableReader +import java.nio.file.Files +import java.nio.file.Path +import java.util.stream.Collectors +import kotlin.io.path.bufferedReader +import kotlin.io.path.extension +import kotlin.io.path.nameWithoutExtension + +/** + * A format implementation for the extended Bitbrains trace format. + */ +public class BitbrainsExTraceFormat : TraceFormat { + /** + * The name of this trace format. + */ + override val name: String = "bitbrains-ex" + + override fun create(path: Path) { + throw UnsupportedOperationException("Writing not supported for this format") + } + + override fun getTables(path: Path): List = listOf(TABLE_RESOURCE_STATES) + + override fun getDetails( + path: Path, + table: String, + ): TableDetails { + return when (table) { + TABLE_RESOURCE_STATES -> + TableDetails( + listOf( + TableColumn(resourceID, TableColumnType.String), + TableColumn(resourceClusterID, TableColumnType.String), + TableColumn(resourceStateTimestamp, TableColumnType.Instant), + TableColumn(resourceCpuCount, TableColumnType.Int), + TableColumn(resourceCpuCapacity, TableColumnType.Double), + TableColumn(resourceStateCpuUsage, TableColumnType.Double), + TableColumn(resourceStateCpuUsagePct, TableColumnType.Double), + TableColumn(resourceStateCpuDemand, TableColumnType.Double), + TableColumn(resourceStateCpuReadyPct, TableColumnType.Double), + TableColumn(resourceMemCapacity, TableColumnType.Double), + TableColumn(resourceStateDiskRead, TableColumnType.Double), + TableColumn(resourceStateDiskWrite, TableColumnType.Double), + ), + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader( + path: Path, + table: String, + projection: List?, + ): TableReader { + return when (table) { + TABLE_RESOURCE_STATES -> newResourceStateReader(path) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter( + path: Path, + table: String, + ): TableWriter { + throw UnsupportedOperationException("Writing not supported for this format") + } + + /** + * Construct a [TableReader] for reading over all resource state partitions. + */ + private fun newResourceStateReader(path: Path): TableReader { + val partitions = + Files.walk(path, 1) + .filter { !Files.isDirectory(it) && it.extension == "txt" } + .collect(Collectors.toMap({ it.nameWithoutExtension }, { it })) + .toSortedMap() + val it = partitions.iterator() + + return object : CompositeTableReader() { + override fun nextReader(): TableReader? { + return if (it.hasNext()) { + val (_, partPath) = it.next() + return BitbrainsExResourceStateTableReader(partPath.bufferedReader()) + } else { + null + } + } + + override fun toString(): String = "BitbrainsExCompositeTableReader" + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsResourceStateTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsResourceStateTableReader.kt new file mode 100644 index 00000000..e264fccb --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsResourceStateTableReader.kt @@ -0,0 +1,365 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.bitbrains + +import com.fasterxml.jackson.core.JsonParseException +import com.fasterxml.jackson.core.JsonToken +import com.fasterxml.jackson.dataformat.csv.CsvParser +import com.fasterxml.jackson.dataformat.csv.CsvSchema +import org.opendc.trace.TableReader +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateCpuUsagePct +import org.opendc.trace.conv.resourceStateDiskRead +import org.opendc.trace.conv.resourceStateDiskWrite +import org.opendc.trace.conv.resourceStateMemUsage +import org.opendc.trace.conv.resourceStateNetRx +import org.opendc.trace.conv.resourceStateNetTx +import org.opendc.trace.conv.resourceStateTimestamp +import java.text.NumberFormat +import java.time.Duration +import java.time.Instant +import java.time.LocalDateTime +import java.time.ZoneOffset +import java.time.format.DateTimeFormatter +import java.time.format.DateTimeParseException +import java.util.Locale +import java.util.UUID + +/** + * A [TableReader] for the Bitbrains resource state table. + */ +internal class BitbrainsResourceStateTableReader(private val partition: String, private val parser: CsvParser) : TableReader { + /** + * A flag to indicate whether a single row has been read already. + */ + private var isStarted = false + + /** + * The [DateTimeFormatter] used to parse the timestamps in case of the Materna trace. + */ + private val formatter = DateTimeFormatter.ofPattern("dd.MM.yyyy HH:mm:ss") + + /** + * The type of timestamps in the trace. + */ + private var timestampType: TimestampType = TimestampType.UNDECIDED + + /** + * The [NumberFormat] used to parse doubles containing a comma. + */ + private val nf = NumberFormat.getInstance(Locale.GERMAN) + + /** + * A flag to indicate that the trace contains decimals with a comma separator. + */ + private var usesCommaDecimalSeparator = false + + init { + parser.schema = schema + } + + override fun nextRow(): Boolean { + if (!isStarted) { + isStarted = true + } + + // Reset the row state + reset() + + if (!nextStart()) { + return false + } + + while (true) { + val token = parser.nextValue() + + if (token == null || token == JsonToken.END_OBJECT) { + break + } + + when (parser.currentName) { + "Timestamp [ms]" -> { + timestamp = + when (timestampType) { + TimestampType.UNDECIDED -> { + try { + val res = LocalDateTime.parse(parser.text, formatter).toInstant(ZoneOffset.UTC) + timestampType = TimestampType.DATE_TIME + res + } catch (e: DateTimeParseException) { + timestampType = TimestampType.EPOCH_MILLIS + Instant.ofEpochSecond(parser.longValue) + } + } + TimestampType.DATE_TIME -> LocalDateTime.parse(parser.text, formatter).toInstant(ZoneOffset.UTC) + TimestampType.EPOCH_MILLIS -> Instant.ofEpochSecond(parser.longValue) + } + } + "CPU cores" -> cpuCores = parser.intValue + "CPU capacity provisioned [MHZ]" -> cpuCapacity = parseSafeDouble() + "CPU usage [MHZ]" -> cpuUsage = parseSafeDouble() + "CPU usage [%]" -> cpuUsagePct = parseSafeDouble() / 100.0 // Convert to range [0, 1] + "Memory capacity provisioned [KB]" -> memCapacity = parseSafeDouble() + "Memory usage [KB]" -> memUsage = parseSafeDouble() + "Disk read throughput [KB/s]" -> diskRead = parseSafeDouble() + "Disk write throughput [KB/s]" -> diskWrite = parseSafeDouble() + "Network received throughput [KB/s]" -> netReceived = parseSafeDouble() + "Network transmitted throughput [KB/s]" -> netTransmitted = parseSafeDouble() + } + } + + return true + } + + private val colTimestamp = 0 + private val colCpuCount = 1 + private val colCpuCapacity = 2 + private val colCpuUsage = 3 + private val colCpuUsagePct = 4 + private val colMemCapacity = 5 + private val colMemUsage = 6 + private val colDiskRead = 7 + private val colDiskWrite = 8 + private val colNetRx = 9 + private val colNetTx = 10 + private val colID = 11 + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + resourceStateTimestamp -> colTimestamp + resourceCpuCount -> colCpuCount + resourceCpuCapacity -> colCpuCapacity + resourceStateCpuUsage -> colCpuUsage + resourceStateCpuUsagePct -> colCpuUsagePct + resourceMemCapacity -> colMemCapacity + resourceStateMemUsage -> colMemUsage + resourceStateDiskRead -> colDiskRead + resourceStateDiskWrite -> colDiskWrite + resourceStateNetRx -> colNetRx + resourceStateNetTx -> colNetTx + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0..colID) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + checkActive() + return when (index) { + colCpuCount -> cpuCores + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + checkActive() + return when (index) { + colCpuCapacity -> cpuCapacity + colCpuUsage -> cpuUsage + colCpuUsagePct -> cpuUsagePct + colMemCapacity -> memCapacity + colMemUsage -> memUsage + colDiskRead -> diskRead + colDiskWrite -> diskWrite + colNetRx -> netReceived + colNetTx -> netTransmitted + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getString(index: Int): String { + checkActive() + return when (index) { + colID -> partition + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant? { + checkActive() + return when (index) { + colTimestamp -> timestamp + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getDuration(index: Int): Duration? { + throw IllegalArgumentException("Invalid column") + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + throw IllegalArgumentException("Invalid column") + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + parser.close() + } + + /** + * Helper method to check if the reader is active. + */ + private fun checkActive() { + check(isStarted && !parser.isClosed) { "No active row. Did you call nextRow()?" } + } + + /** + * Advance the parser until the next object start. + */ + private fun nextStart(): Boolean { + var token = parser.nextValue() + + while (token != null && token != JsonToken.START_OBJECT) { + token = parser.nextValue() + } + + return token != null + } + + /** + * Try to parse the current value safely as double. + */ + private fun parseSafeDouble(): Double { + if (!usesCommaDecimalSeparator) { + try { + return parser.doubleValue + } catch (e: JsonParseException) { + usesCommaDecimalSeparator = true + } + } + + val text = parser.text + if (text.isBlank()) { + return 0.0 + } + + return nf.parse(text).toDouble() + } + + /** + * State fields of the reader. + */ + private var timestamp: Instant? = null + private var cpuCores = -1 + private var cpuCapacity = Double.NaN + private var cpuUsage = Double.NaN + private var cpuUsagePct = Double.NaN + private var memCapacity = Double.NaN + private var memUsage = Double.NaN + private var diskRead = Double.NaN + private var diskWrite = Double.NaN + private var netReceived = Double.NaN + private var netTransmitted = Double.NaN + + /** + * Reset the state. + */ + private fun reset() { + timestamp = null + cpuCores = -1 + cpuCapacity = Double.NaN + cpuUsage = Double.NaN + cpuUsagePct = Double.NaN + memCapacity = Double.NaN + memUsage = Double.NaN + diskRead = Double.NaN + diskWrite = Double.NaN + netReceived = Double.NaN + netTransmitted = Double.NaN + } + + /** + * The type of the timestamp in the trace. + */ + private enum class TimestampType { + UNDECIDED, + DATE_TIME, + EPOCH_MILLIS, + } + + companion object { + /** + * The [CsvSchema] that is used to parse the trace. + */ + private val schema = + CsvSchema.builder() + .addColumn("Timestamp [ms]", CsvSchema.ColumnType.NUMBER_OR_STRING) + .addColumn("CPU cores", CsvSchema.ColumnType.NUMBER) + .addColumn("CPU capacity provisioned [MHZ]", CsvSchema.ColumnType.NUMBER) + .addColumn("CPU usage [MHZ]", CsvSchema.ColumnType.NUMBER) + .addColumn("CPU usage [%]", CsvSchema.ColumnType.NUMBER) + .addColumn("Memory capacity provisioned [KB]", CsvSchema.ColumnType.NUMBER) + .addColumn("Memory usage [KB]", CsvSchema.ColumnType.NUMBER) + .addColumn("Memory usage [%]", CsvSchema.ColumnType.NUMBER) + .addColumn("Disk read throughput [KB/s]", CsvSchema.ColumnType.NUMBER) + .addColumn("Disk write throughput [KB/s]", CsvSchema.ColumnType.NUMBER) + .addColumn("Disk size [GB]", CsvSchema.ColumnType.NUMBER) + .addColumn("Network received throughput [KB/s]", CsvSchema.ColumnType.NUMBER) + .addColumn("Network transmitted throughput [KB/s]", CsvSchema.ColumnType.NUMBER) + .setAllowComments(true) + .setUseHeader(true) + .setColumnSeparator(';') + .build() + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsResourceTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsResourceTableReader.kt new file mode 100644 index 00000000..a12785f0 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsResourceTableReader.kt @@ -0,0 +1,175 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.bitbrains + +import com.fasterxml.jackson.dataformat.csv.CsvFactory +import org.opendc.trace.TableReader +import org.opendc.trace.conv.resourceID +import java.nio.file.Path +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] for the Bitbrains resource table. + */ +internal class BitbrainsResourceTableReader(private val factory: CsvFactory, vms: Map) : TableReader { + /** + * An iterator to iterate over the resource entries. + */ + private val it = vms.iterator() + + /** + * The state of the reader. + */ + private var state = State.Pending + + override fun nextRow(): Boolean { + if (state == State.Pending) { + state = State.Active + } + + reset() + + while (it.hasNext()) { + val (name, path) = it.next() + + val parser = factory.createParser(path.toFile()) + val reader = BitbrainsResourceStateTableReader(name, parser) + val idCol = reader.resolve(resourceID) + + try { + if (!reader.nextRow()) { + continue + } + + id = reader.getString(idCol) + return true + } finally { + reader.close() + } + } + + state = State.Closed + return false + } + + private val colID = 0 + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0..colID) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + throw IllegalArgumentException("Invalid column") + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + throw IllegalArgumentException("Invalid column") + } + + override fun getString(index: Int): String? { + check(state == State.Active) { "No active row" } + return when (index) { + colID -> id + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant? { + throw IllegalArgumentException("Invalid column") + } + + override fun getDuration(index: Int): Duration? { + throw IllegalArgumentException("Invalid column") + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + throw IllegalArgumentException("Invalid column") + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + reset() + state = State.Closed + } + + /** + * State fields of the reader. + */ + private var id: String? = null + + /** + * Reset the state of the reader. + */ + private fun reset() { + id = null + } + + private enum class State { + Pending, + Active, + Closed, + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsTraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsTraceFormat.kt new file mode 100644 index 00000000..23853077 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/bitbrains/BitbrainsTraceFormat.kt @@ -0,0 +1,159 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.bitbrains + +import com.fasterxml.jackson.dataformat.csv.CsvFactory +import com.fasterxml.jackson.dataformat.csv.CsvParser +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.TABLE_RESOURCES +import org.opendc.trace.conv.TABLE_RESOURCE_STATES +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateCpuUsagePct +import org.opendc.trace.conv.resourceStateDiskRead +import org.opendc.trace.conv.resourceStateDiskWrite +import org.opendc.trace.conv.resourceStateMemUsage +import org.opendc.trace.conv.resourceStateNetRx +import org.opendc.trace.conv.resourceStateNetTx +import org.opendc.trace.conv.resourceStateTimestamp +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import org.opendc.trace.util.CompositeTableReader +import java.nio.file.Files +import java.nio.file.Path +import java.util.stream.Collectors +import kotlin.io.path.extension +import kotlin.io.path.nameWithoutExtension + +/** + * A format implementation for the GWF trace format. + */ +public class BitbrainsTraceFormat : TraceFormat { + /** + * The name of this trace format. + */ + override val name: String = "bitbrains" + + /** + * The [CsvFactory] used to create the parser. + */ + private val factory = + CsvFactory() + .enable(CsvParser.Feature.ALLOW_COMMENTS) + .enable(CsvParser.Feature.TRIM_SPACES) + + override fun create(path: Path) { + throw UnsupportedOperationException("Writing not supported for this format") + } + + override fun getTables(path: Path): List = listOf(TABLE_RESOURCES, TABLE_RESOURCE_STATES) + + override fun getDetails( + path: Path, + table: String, + ): TableDetails { + return when (table) { + TABLE_RESOURCES -> + TableDetails( + listOf( + TableColumn(resourceID, TableColumnType.String), + ), + ) + TABLE_RESOURCE_STATES -> + TableDetails( + listOf( + TableColumn(resourceID, TableColumnType.String), + TableColumn(resourceStateTimestamp, TableColumnType.Instant), + TableColumn(resourceCpuCount, TableColumnType.Int), + TableColumn(resourceCpuCapacity, TableColumnType.Double), + TableColumn(resourceStateCpuUsage, TableColumnType.Double), + TableColumn(resourceStateCpuUsagePct, TableColumnType.Double), + TableColumn(resourceMemCapacity, TableColumnType.Double), + TableColumn(resourceStateMemUsage, TableColumnType.Double), + TableColumn(resourceStateDiskRead, TableColumnType.Double), + TableColumn(resourceStateDiskWrite, TableColumnType.Double), + TableColumn(resourceStateNetRx, TableColumnType.Double), + TableColumn(resourceStateNetTx, TableColumnType.Double), + ), + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader( + path: Path, + table: String, + projection: List?, + ): TableReader { + return when (table) { + TABLE_RESOURCES -> { + val vms = + Files.walk(path, 1) + .filter { !Files.isDirectory(it) && it.extension == "csv" } + .collect(Collectors.toMap({ it.nameWithoutExtension }, { it })) + .toSortedMap() + BitbrainsResourceTableReader(factory, vms) + } + TABLE_RESOURCE_STATES -> newResourceStateReader(path) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter( + path: Path, + table: String, + ): TableWriter { + throw UnsupportedOperationException("Writing not supported for this format") + } + + /** + * Construct a [TableReader] for reading over all resource state partitions. + */ + private fun newResourceStateReader(path: Path): TableReader { + val partitions = + Files.walk(path, 1) + .filter { !Files.isDirectory(it) && it.extension == "csv" } + .collect(Collectors.toMap({ it.nameWithoutExtension }, { it })) + .toSortedMap() + val it = partitions.iterator() + + return object : CompositeTableReader() { + override fun nextReader(): TableReader? { + return if (it.hasNext()) { + val (partition, partPath) = it.next() + return BitbrainsResourceStateTableReader(partition, factory.createParser(partPath.toFile())) + } else { + null + } + } + + override fun toString(): String = "BitbrainsCompositeTableReader" + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/gwf/GwfTaskTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/gwf/GwfTaskTableReader.kt new file mode 100644 index 00000000..8a2a99cb --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/gwf/GwfTaskTableReader.kt @@ -0,0 +1,286 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.gwf + +import com.fasterxml.jackson.core.JsonToken +import com.fasterxml.jackson.dataformat.csv.CsvParser +import com.fasterxml.jackson.dataformat.csv.CsvSchema +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.conv.TASK_ALLOC_NCPUS +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import org.opendc.trace.util.convertTo +import java.time.Duration +import java.time.Instant +import java.util.UUID +import java.util.regex.Pattern + +/** + * A [TableReader] implementation for the GWF format. + */ +internal class GwfTaskTableReader(private val parser: CsvParser) : TableReader { + /** + * A flag to indicate whether a single row has been read already. + */ + private var isStarted = false + + init { + parser.schema = schema + } + + override fun nextRow(): Boolean { + if (!isStarted) { + isStarted = true + } + + // Reset the row state + reset() + + if (parser.isClosed || !nextStart()) { + return false + } + + while (true) { + val token = parser.nextValue() + + if (token == null || token == JsonToken.END_OBJECT) { + break + } + + when (parser.currentName) { + "WorkflowID" -> workflowId = parser.text + "JobID" -> jobId = parser.text + "SubmitTime" -> submitTime = Instant.ofEpochSecond(parser.longValue) + "RunTime" -> runtime = Duration.ofSeconds(parser.longValue) + "NProcs" -> nProcs = parser.intValue + "ReqNProcs" -> reqNProcs = parser.intValue + "Dependencies" -> dependencies = parseParents(parser.valueAsString) + } + } + + return true + } + + override fun resolve(name: String): Int { + return when (name) { + TASK_ID -> colJobID + TASK_WORKFLOW_ID -> colWorkflowID + TASK_SUBMIT_TIME -> colSubmitTime + TASK_RUNTIME -> colRuntime + TASK_ALLOC_NCPUS -> colNproc + TASK_REQ_NCPUS -> colReqNproc + TASK_PARENTS -> colDeps + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0..colDeps) { "Invalid column" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + checkActive() + return when (index) { + colReqNproc -> reqNProcs + colNproc -> nProcs + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + throw IllegalArgumentException("Invalid column") + } + + override fun getString(index: Int): String? { + checkActive() + return when (index) { + colJobID -> jobId + colWorkflowID -> workflowId + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant? { + checkActive() + return when (index) { + colSubmitTime -> submitTime + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getDuration(index: Int): Duration? { + checkActive() + return when (index) { + colRuntime -> runtime + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + checkActive() + return when (index) { + colDeps -> typeDeps.convertTo(dependencies, elementType) + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun close() { + parser.close() + } + + /** + * Helper method to check if the reader is active. + */ + private fun checkActive() { + check(isStarted && !parser.isClosed) { "No active row. Did you call nextRow()?" } + } + + /** + * The pattern used to parse the parents. + */ + private val pattern = Pattern.compile("\\s+") + + /** + * Parse the parents into a set of longs. + */ + private fun parseParents(value: String): Set { + val result = mutableSetOf() + val deps = value.split(pattern) + + for (dep in deps) { + if (dep.isBlank()) { + continue + } + + result.add(dep) + } + + return result + } + + /** + * Advance the parser until the next object start. + */ + private fun nextStart(): Boolean { + var token = parser.nextValue() + + while (token != null && token != JsonToken.START_OBJECT) { + token = parser.nextValue() + } + + return token != null + } + + /** + * Reader state fields. + */ + private var workflowId: String? = null + private var jobId: String? = null + private var submitTime: Instant? = null + private var runtime: Duration? = null + private var nProcs = -1 + private var reqNProcs = -1 + private var dependencies = emptySet() + + /** + * Reset the state. + */ + private fun reset() { + workflowId = null + jobId = null + submitTime = null + runtime = null + nProcs = -1 + reqNProcs = -1 + dependencies = emptySet() + } + + private val colWorkflowID = 0 + private val colJobID = 1 + private val colSubmitTime = 2 + private val colRuntime = 3 + private val colNproc = 4 + private val colReqNproc = 5 + private val colDeps = 6 + + private val typeDeps = TableColumnType.Set(TableColumnType.String) + + companion object { + /** + * The [CsvSchema] that is used to parse the trace. + */ + private val schema = + CsvSchema.builder() + .addColumn("WorkflowID", CsvSchema.ColumnType.NUMBER) + .addColumn("JobID", CsvSchema.ColumnType.NUMBER) + .addColumn("SubmitTime", CsvSchema.ColumnType.NUMBER) + .addColumn("RunTime", CsvSchema.ColumnType.NUMBER) + .addColumn("NProcs", CsvSchema.ColumnType.NUMBER) + .addColumn("ReqNProcs", CsvSchema.ColumnType.NUMBER) + .addColumn("Dependencies", CsvSchema.ColumnType.STRING) + .setAllowComments(true) + .setUseHeader(true) + .setColumnSeparator(',') + .build() + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/gwf/GwfTraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/gwf/GwfTraceFormat.kt new file mode 100644 index 00000000..097c5593 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/gwf/GwfTraceFormat.kt @@ -0,0 +1,104 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.gwf + +import com.fasterxml.jackson.dataformat.csv.CsvFactory +import com.fasterxml.jackson.dataformat.csv.CsvParser +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.TABLE_TASKS +import org.opendc.trace.conv.TASK_ALLOC_NCPUS +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import java.nio.file.Path + +/** + * A [TraceFormat] implementation for the GWF trace format. + */ +public class GwfTraceFormat : TraceFormat { + /** + * The name of this trace format. + */ + override val name: String = "gwf" + + /** + * The [CsvFactory] used to create the parser. + */ + private val factory = + CsvFactory() + .enable(CsvParser.Feature.ALLOW_COMMENTS) + .enable(CsvParser.Feature.TRIM_SPACES) + + override fun create(path: Path) { + throw UnsupportedOperationException("Writing not supported for this format") + } + + override fun getTables(path: Path): List = listOf(TABLE_TASKS) + + override fun getDetails( + path: Path, + table: String, + ): TableDetails { + return when (table) { + TABLE_TASKS -> + TableDetails( + listOf( + TableColumn(TASK_WORKFLOW_ID, TableColumnType.String), + TableColumn(TASK_ID, TableColumnType.String), + TableColumn(TASK_SUBMIT_TIME, TableColumnType.Instant), + TableColumn(TASK_RUNTIME, TableColumnType.Duration), + TableColumn(TASK_REQ_NCPUS, TableColumnType.Int), + TableColumn(TASK_ALLOC_NCPUS, TableColumnType.Int), + TableColumn(TASK_PARENTS, TableColumnType.Set(TableColumnType.String)), + ), + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader( + path: Path, + table: String, + projection: List?, + ): TableReader { + return when (table) { + TABLE_TASKS -> GwfTaskTableReader(factory.createParser(path.toFile())) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter( + path: Path, + table: String, + ): TableWriter { + throw UnsupportedOperationException("Writing not supported for this format") + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmInterferenceJsonTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmInterferenceJsonTableReader.kt new file mode 100644 index 00000000..dba971d7 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmInterferenceJsonTableReader.kt @@ -0,0 +1,225 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc + +import com.fasterxml.jackson.core.JsonParseException +import com.fasterxml.jackson.core.JsonParser +import com.fasterxml.jackson.core.JsonToken +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.conv.INTERFERENCE_GROUP_MEMBERS +import org.opendc.trace.conv.INTERFERENCE_GROUP_SCORE +import org.opendc.trace.conv.INTERFERENCE_GROUP_TARGET +import org.opendc.trace.util.convertTo +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] implementation for the OpenDC VM interference JSON format. + */ +internal class OdcVmInterferenceJsonTableReader(private val parser: JsonParser) : TableReader { + /** + * A flag to indicate whether a single row has been read already. + */ + private var isStarted = false + + override fun nextRow(): Boolean { + if (!isStarted) { + isStarted = true + + parser.nextToken() + + if (!parser.isExpectedStartArrayToken) { + throw JsonParseException(parser, "Expected array at start, but got ${parser.currentToken()}") + } + } + + return if (parser.isClosed || parser.nextToken() == JsonToken.END_ARRAY) { + parser.close() + reset() + false + } else { + parseGroup(parser) + true + } + } + + private val colMembers = 0 + private val colTarget = 1 + private val colScore = 2 + + private val typeMembers = TableColumnType.Set(TableColumnType.String) + + override fun resolve(name: String): Int { + return when (name) { + INTERFERENCE_GROUP_MEMBERS -> colMembers + INTERFERENCE_GROUP_TARGET -> colTarget + INTERFERENCE_GROUP_SCORE -> colScore + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + return when (index) { + colMembers, colTarget, colScore -> false + else -> throw IllegalArgumentException("Invalid column index $index") + } + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getInt(index: Int): Int { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getDouble(index: Int): Double { + checkActive() + return when (index) { + colTarget -> targetLoad + colScore -> score + else -> throw IllegalArgumentException("Invalid column $index") + } + } + + override fun getString(index: Int): String? { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getInstant(index: Int): Instant? { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getDuration(index: Int): Duration? { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column $index") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + checkActive() + return when (index) { + colMembers -> typeMembers.convertTo(members, elementType) + else -> throw IllegalArgumentException("Invalid column $index") + } + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column $index") + } + + override fun close() { + parser.close() + } + + private var members = emptySet() + private var targetLoad = Double.POSITIVE_INFINITY + private var score = 1.0 + + /** + * Helper method to check if the reader is active. + */ + private fun checkActive() { + check(isStarted && !parser.isClosed) { "No active row. Did you call nextRow()?" } + } + + /** + * Reset the state. + */ + private fun reset() { + members = emptySet() + targetLoad = Double.POSITIVE_INFINITY + score = 1.0 + } + + /** + * Parse a group an interference JSON file. + */ + private fun parseGroup(parser: JsonParser) { + var targetLoad = Double.POSITIVE_INFINITY + var score = 1.0 + val members = mutableSetOf() + + if (!parser.isExpectedStartObjectToken) { + throw JsonParseException(parser, "Expected object, but got ${parser.currentToken()}") + } + + while (parser.nextValue() != JsonToken.END_OBJECT) { + when (parser.currentName) { + "vms" -> parseGroupMembers(parser, members) + "minServerLoad" -> targetLoad = parser.doubleValue + "performanceScore" -> score = parser.doubleValue + } + } + + this.members = members + this.targetLoad = targetLoad + this.score = score + } + + /** + * Parse the members of a group. + */ + private fun parseGroupMembers( + parser: JsonParser, + members: MutableSet, + ) { + if (!parser.isExpectedStartArrayToken) { + throw JsonParseException(parser, "Expected array for group members, but got ${parser.currentToken()}") + } + + while (parser.nextValue() != JsonToken.END_ARRAY) { + if (parser.currentToken() != JsonToken.VALUE_STRING) { + throw JsonParseException(parser, "Expected string value for group member") + } + + members.add(parser.text) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmInterferenceJsonTableWriter.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmInterferenceJsonTableWriter.kt new file mode 100644 index 00000000..b3286a1c --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmInterferenceJsonTableWriter.kt @@ -0,0 +1,192 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc + +import com.fasterxml.jackson.core.JsonGenerator +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.INTERFERENCE_GROUP_MEMBERS +import org.opendc.trace.conv.INTERFERENCE_GROUP_SCORE +import org.opendc.trace.conv.INTERFERENCE_GROUP_TARGET +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableWriter] implementation for the OpenDC VM interference JSON format. + */ +internal class OdcVmInterferenceJsonTableWriter(private val generator: JsonGenerator) : TableWriter { + /** + * A flag to indicate whether a row has been started. + */ + private var isRowActive = false + + init { + generator.writeStartArray() + } + + override fun startRow() { + // Reset state + members = emptySet() + targetLoad = Double.POSITIVE_INFINITY + score = 1.0 + + // Mark row as active + isRowActive = true + } + + override fun endRow() { + check(isRowActive) { "No active row" } + + generator.writeStartObject() + generator.writeArrayFieldStart("vms") + for (member in members) { + generator.writeString(member) + } + generator.writeEndArray() + generator.writeNumberField("minServerLoad", targetLoad) + generator.writeNumberField("performanceScore", score) + generator.writeEndObject() + } + + override fun resolve(name: String): Int { + return when (name) { + INTERFERENCE_GROUP_MEMBERS -> colMembers + INTERFERENCE_GROUP_TARGET -> colTarget + INTERFERENCE_GROUP_SCORE -> colScore + else -> -1 + } + } + + override fun setBoolean( + index: Int, + value: Boolean, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setInt( + index: Int, + value: Int, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setLong( + index: Int, + value: Long, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setFloat( + index: Int, + value: Float, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setDouble( + index: Int, + value: Double, + ) { + check(isRowActive) { "No active row" } + + when (index) { + colTarget -> targetLoad = (value as Number).toDouble() + colScore -> score = (value as Number).toDouble() + else -> throw IllegalArgumentException("Invalid column $index") + } + } + + override fun setString( + index: Int, + value: String, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setUUID( + index: Int, + value: UUID, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setInstant( + index: Int, + value: Instant, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setDuration( + index: Int, + value: Duration, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setList( + index: Int, + value: List, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun setSet( + index: Int, + value: Set, + ) { + check(isRowActive) { "No active row" } + + @Suppress("UNCHECKED_CAST") + when (index) { + colMembers -> members = value as Set + else -> throw IllegalArgumentException("Invalid column index $index") + } + } + + override fun setMap( + index: Int, + value: Map, + ) { + throw IllegalArgumentException("Invalid column $index") + } + + override fun flush() { + generator.flush() + } + + override fun close() { + generator.writeEndArray() + generator.close() + } + + private val colMembers = 0 + private val colTarget = 1 + private val colScore = 2 + + private var members = emptySet() + private var targetLoad = Double.POSITIVE_INFINITY + private var score = 1.0 +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceStateTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceStateTableReader.kt new file mode 100644 index 00000000..39475f9f --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceStateTableReader.kt @@ -0,0 +1,166 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc + +import org.opendc.trace.TableReader +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateDuration +import org.opendc.trace.conv.resourceStateTimestamp +import org.opendc.trace.formats.opendc.parquet.ResourceState +import org.opendc.trace.util.parquet.LocalParquetReader +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] implementation for the OpenDC virtual machine trace format. + */ +internal class OdcVmResourceStateTableReader(private val reader: LocalParquetReader) : TableReader { + /** + * The current record. + */ + private var record: ResourceState? = null + + override fun nextRow(): Boolean { + try { + val record = reader.read() + this.record = record + + return record != null + } catch (e: Throwable) { + this.record = null + throw e + } + } + + private val colID = 0 + private val colTimestamp = 1 + private val colDuration = 2 + private val colCpuCount = 3 + private val colCpuUsage = 4 + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + resourceStateTimestamp -> colTimestamp + resourceStateDuration -> colDuration + resourceCpuCount -> colCpuCount + resourceStateCpuUsage -> colCpuUsage + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0..colCpuUsage) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun getInt(index: Int): Int { + val record = checkNotNull(record) { "Reader in invalid state" } + return when (index) { + colCpuCount -> record.cpuCount + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun getDouble(index: Int): Double { + val record = checkNotNull(record) { "Reader in invalid state" } + return when (index) { + colCpuUsage -> record.cpuUsage + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun getString(index: Int): String { + val record = checkNotNull(record) { "Reader in invalid state" } + + return when (index) { + colID -> record.id + else -> throw IllegalArgumentException("Invalid column index $index") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun getInstant(index: Int): Instant { + val record = checkNotNull(record) { "Reader in invalid state" } + + return when (index) { + colTimestamp -> record.timestamp + else -> throw IllegalArgumentException("Invalid column index $index") + } + } + + override fun getDuration(index: Int): Duration { + val record = checkNotNull(record) { "Reader in invalid state" } + + return when (index) { + colDuration -> record.duration + else -> throw IllegalArgumentException("Invalid column index $index") + } + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun close() { + reader.close() + } + + override fun toString(): String = "OdcVmResourceStateTableReader" +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceStateTableWriter.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceStateTableWriter.kt new file mode 100644 index 00000000..1421d77c --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceStateTableWriter.kt @@ -0,0 +1,209 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc + +import org.apache.parquet.hadoop.ParquetWriter +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateDuration +import org.opendc.trace.conv.resourceStateTimestamp +import org.opendc.trace.formats.opendc.parquet.ResourceState +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableWriter] implementation for the OpenDC virtual machine trace format. + */ +internal class OdcVmResourceStateTableWriter(private val writer: ParquetWriter) : TableWriter { + /** + * The current state for the record that is being written. + */ + private var localIsActive = false + private var localID: String = "" + private var localTimestamp: Instant = Instant.MIN + private var localDuration: Duration = Duration.ZERO + private var localCpuCount: Int = 0 + private var localCpuUsage: Double = Double.NaN + + override fun startRow() { + localIsActive = true + localID = "" + localTimestamp = Instant.MIN + localDuration = Duration.ZERO + localCpuCount = 0 + localCpuUsage = Double.NaN + } + + override fun endRow() { + check(localIsActive) { "No active row" } + localIsActive = false + + check(lastId != localID || localTimestamp >= lastTimestamp) { "Records need to be ordered by (id, timestamp)" } + + writer.write(ResourceState(localID, localTimestamp, localDuration, localCpuCount, localCpuUsage)) + + lastId = localID + lastTimestamp = localTimestamp + } + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + resourceStateTimestamp -> colTimestamp + resourceStateDuration -> colDuration + resourceCpuCount -> colCpuCount + resourceStateCpuUsage -> colCpuUsage + else -> -1 + } + } + + override fun setBoolean( + index: Int, + value: Boolean, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setInt( + index: Int, + value: Int, + ) { + check(localIsActive) { "No active row" } + when (index) { + colCpuCount -> localCpuCount = value + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun setLong( + index: Int, + value: Long, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setFloat( + index: Int, + value: Float, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setDouble( + index: Int, + value: Double, + ) { + check(localIsActive) { "No active row" } + when (index) { + colCpuUsage -> localCpuUsage = value + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun setString( + index: Int, + value: String, + ) { + check(localIsActive) { "No active row" } + + when (index) { + colID -> localID = value + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun setUUID( + index: Int, + value: UUID, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setInstant( + index: Int, + value: Instant, + ) { + check(localIsActive) { "No active row" } + + when (index) { + colTimestamp -> localTimestamp = value + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun setDuration( + index: Int, + value: Duration, + ) { + check(localIsActive) { "No active row" } + + when (index) { + colDuration -> localDuration = value + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun setList( + index: Int, + value: List, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setSet( + index: Int, + value: Set, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setMap( + index: Int, + value: Map, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun flush() { + // Not available + } + + override fun close() { + writer.close() + } + + /** + * Last column values that are used to check for correct partitioning. + */ + private var lastId: String? = null + private var lastTimestamp: Instant = Instant.MAX + + private val colID = 0 + private val colTimestamp = 1 + private val colDuration = 2 + private val colCpuCount = 3 + private val colCpuUsage = 4 +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceTableReader.kt new file mode 100644 index 00000000..34197d7f --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceTableReader.kt @@ -0,0 +1,168 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc + +import org.opendc.trace.TableReader +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStartTime +import org.opendc.trace.conv.resourceStopTime +import org.opendc.trace.formats.opendc.parquet.Resource +import org.opendc.trace.util.parquet.LocalParquetReader +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] implementation for the "resources table" in the OpenDC virtual machine trace format. + */ +internal class OdcVmResourceTableReader(private val reader: LocalParquetReader) : TableReader { + /** + * The current record. + */ + private var record: Resource? = null + + override fun nextRow(): Boolean { + try { + val record = reader.read() + this.record = record + + return record != null + } catch (e: Throwable) { + this.record = null + throw e + } + } + + private val colID = 0 + private val colStartTime = 1 + private val colStopTime = 2 + private val colCpuCount = 3 + private val colCpuCapacity = 4 + private val colMemCapacity = 5 + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + resourceStartTime -> colStartTime + resourceStopTime -> colStopTime + resourceCpuCount -> colCpuCount + resourceCpuCapacity -> colCpuCapacity + resourceMemCapacity -> colMemCapacity + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0..colMemCapacity) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + val record = checkNotNull(record) { "Reader in invalid state" } + + return when (index) { + colCpuCount -> record.cpuCount + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + val record = checkNotNull(record) { "Reader in invalid state" } + + return when (index) { + colCpuCapacity -> record.cpuCapacity + colMemCapacity -> record.memCapacity + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getString(index: Int): String { + val record = checkNotNull(record) { "Reader in invalid state" } + + return when (index) { + colID -> record.id + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant { + val record = checkNotNull(record) { "Reader in invalid state" } + + return when (index) { + colStartTime -> record.startTime + colStopTime -> record.stopTime + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getDuration(index: Int): Duration? { + throw IllegalArgumentException("Invalid column") + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + throw IllegalArgumentException("Invalid column") + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + reader.close() + } + + override fun toString(): String = "OdcVmResourceTableReader" +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceTableWriter.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceTableWriter.kt new file mode 100644 index 00000000..e0a11368 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmResourceTableWriter.kt @@ -0,0 +1,197 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc + +import org.apache.parquet.hadoop.ParquetWriter +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStartTime +import org.opendc.trace.conv.resourceStopTime +import org.opendc.trace.formats.opendc.parquet.Resource +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableWriter] implementation for the OpenDC virtual machine trace format. + */ +internal class OdcVmResourceTableWriter(private val writer: ParquetWriter) : TableWriter { + /** + * The current state for the record that is being written. + */ + private var localIsActive = false + private var localId: String = "" + private var localStartTime: Instant = Instant.MIN + private var localStopTime: Instant = Instant.MIN + private var localCpuCount: Int = 0 + private var localCpuCapacity: Double = Double.NaN + private var localMemCapacity: Double = Double.NaN + + override fun startRow() { + localIsActive = true + localId = "" + localStartTime = Instant.MIN + localStopTime = Instant.MIN + localCpuCount = 0 + localCpuCapacity = Double.NaN + localMemCapacity = Double.NaN + } + + override fun endRow() { + check(localIsActive) { "No active row" } + localIsActive = false + writer.write(Resource(localId, localStartTime, localStopTime, localCpuCount, localCpuCapacity, localMemCapacity)) + } + + override fun resolve(name: String): Int { + return when (name) { + resourceID -> colID + resourceStartTime -> colStartTime + resourceStopTime -> colStopTime + resourceCpuCount -> colCpuCount + resourceCpuCapacity -> colCpuCapacity + resourceMemCapacity -> colMemCapacity + else -> -1 + } + } + + override fun setBoolean( + index: Int, + value: Boolean, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setInt( + index: Int, + value: Int, + ) { + check(localIsActive) { "No active row" } + when (index) { + colCpuCount -> localCpuCount = value + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun setLong( + index: Int, + value: Long, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setFloat( + index: Int, + value: Float, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setDouble( + index: Int, + value: Double, + ) { + check(localIsActive) { "No active row" } + when (index) { + colCpuCapacity -> localCpuCapacity = value + colMemCapacity -> localMemCapacity = value + else -> throw IllegalArgumentException("Invalid column or type [index $index]") + } + } + + override fun setString( + index: Int, + value: String, + ) { + check(localIsActive) { "No active row" } + when (index) { + colID -> localId = value + else -> throw IllegalArgumentException("Invalid column index $index") + } + } + + override fun setUUID( + index: Int, + value: UUID, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setInstant( + index: Int, + value: Instant, + ) { + check(localIsActive) { "No active row" } + when (index) { + colStartTime -> localStartTime = value + colStopTime -> localStopTime = value + else -> throw IllegalArgumentException("Invalid column index $index") + } + } + + override fun setDuration( + index: Int, + value: Duration, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setList( + index: Int, + value: List, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setSet( + index: Int, + value: Set, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun setMap( + index: Int, + value: Map, + ) { + throw IllegalArgumentException("Invalid column or type [index $index]") + } + + override fun flush() { + // Not available + } + + override fun close() { + writer.close() + } + + private val colID = 0 + private val colStartTime = 1 + private val colStopTime = 2 + private val colCpuCount = 3 + private val colCpuCapacity = 4 + private val colMemCapacity = 5 +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmTraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmTraceFormat.kt new file mode 100644 index 00000000..7a7bc834 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/OdcVmTraceFormat.kt @@ -0,0 +1,190 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc + +import com.fasterxml.jackson.core.JsonEncoding +import com.fasterxml.jackson.core.JsonFactory +import org.apache.parquet.column.ParquetProperties +import org.apache.parquet.hadoop.ParquetFileWriter +import org.apache.parquet.hadoop.metadata.CompressionCodecName +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.INTERFERENCE_GROUP_MEMBERS +import org.opendc.trace.conv.INTERFERENCE_GROUP_SCORE +import org.opendc.trace.conv.INTERFERENCE_GROUP_TARGET +import org.opendc.trace.conv.TABLE_INTERFERENCE_GROUPS +import org.opendc.trace.conv.TABLE_RESOURCES +import org.opendc.trace.conv.TABLE_RESOURCE_STATES +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStartTime +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateDuration +import org.opendc.trace.conv.resourceStateTimestamp +import org.opendc.trace.conv.resourceStopTime +import org.opendc.trace.formats.opendc.parquet.ResourceReadSupport +import org.opendc.trace.formats.opendc.parquet.ResourceStateReadSupport +import org.opendc.trace.formats.opendc.parquet.ResourceStateWriteSupport +import org.opendc.trace.formats.opendc.parquet.ResourceWriteSupport +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import org.opendc.trace.util.parquet.LocalParquetReader +import org.opendc.trace.util.parquet.LocalParquetWriter +import java.nio.file.Files +import java.nio.file.Path +import kotlin.io.path.exists + +/** + * A [TraceFormat] implementation of the OpenDC virtual machine trace format. + */ +public class OdcVmTraceFormat : TraceFormat { + /** + * A [JsonFactory] that is used to parse the JSON-based interference model. + */ + private val jsonFactory = JsonFactory() + + /** + * The name of this trace format. + */ + override val name: String = "opendc-vm" + + override fun create(path: Path) { + // Construct directory containing the trace files + Files.createDirectories(path) + + val tables = getTables(path) + + for (table in tables) { + val writer = newWriter(path, table) + writer.close() + } + } + + override fun getTables(path: Path): List = listOf(TABLE_RESOURCES, TABLE_RESOURCE_STATES, TABLE_INTERFERENCE_GROUPS) + + override fun getDetails( + path: Path, + table: String, + ): TableDetails { + return when (table) { + TABLE_RESOURCES -> + TableDetails( + listOf( + TableColumn(resourceID, TableColumnType.String), + TableColumn(resourceStartTime, TableColumnType.Instant), + TableColumn(resourceStopTime, TableColumnType.Instant), + TableColumn(resourceCpuCount, TableColumnType.Int), + TableColumn(resourceCpuCapacity, TableColumnType.Double), + TableColumn(resourceMemCapacity, TableColumnType.Double), + ), + ) + TABLE_RESOURCE_STATES -> + TableDetails( + listOf( + TableColumn(resourceID, TableColumnType.String), + TableColumn(resourceStateTimestamp, TableColumnType.Instant), + TableColumn(resourceStateDuration, TableColumnType.Duration), + TableColumn(resourceCpuCount, TableColumnType.Int), + TableColumn(resourceStateCpuUsage, TableColumnType.Double), + ), + ) + TABLE_INTERFERENCE_GROUPS -> + TableDetails( + listOf( + TableColumn(INTERFERENCE_GROUP_MEMBERS, TableColumnType.Set(TableColumnType.String)), + TableColumn(INTERFERENCE_GROUP_TARGET, TableColumnType.Double), + TableColumn(INTERFERENCE_GROUP_SCORE, TableColumnType.Double), + ), + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader( + path: Path, + table: String, + projection: List?, + ): TableReader { + return when (table) { + TABLE_RESOURCES -> { + val reader = LocalParquetReader(path.resolve("meta.parquet"), ResourceReadSupport(projection)) + OdcVmResourceTableReader(reader) + } + TABLE_RESOURCE_STATES -> { + val reader = LocalParquetReader(path.resolve("trace.parquet"), ResourceStateReadSupport(projection)) + OdcVmResourceStateTableReader(reader) + } + TABLE_INTERFERENCE_GROUPS -> { + val modelPath = path.resolve("interference-model.json") + val parser = + if (modelPath.exists()) { + jsonFactory.createParser(modelPath.toFile()) + } else { + jsonFactory.createParser("[]") // If model does not exist, return empty model + } + + OdcVmInterferenceJsonTableReader(parser) + } + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter( + path: Path, + table: String, + ): TableWriter { + return when (table) { + TABLE_RESOURCES -> { + val writer = + LocalParquetWriter.builder(path.resolve("meta.parquet"), ResourceWriteSupport()) + .withCompressionCodec(CompressionCodecName.ZSTD) + .withPageWriteChecksumEnabled(true) + .withWriterVersion(ParquetProperties.WriterVersion.PARQUET_2_0) + .withWriteMode(ParquetFileWriter.Mode.OVERWRITE) + .build() + OdcVmResourceTableWriter(writer) + } + TABLE_RESOURCE_STATES -> { + val writer = + LocalParquetWriter.builder(path.resolve("trace.parquet"), ResourceStateWriteSupport()) + .withCompressionCodec(CompressionCodecName.ZSTD) + .withDictionaryEncoding("id", true) + .withBloomFilterEnabled("id", true) + .withPageWriteChecksumEnabled(true) + .withWriterVersion(ParquetProperties.WriterVersion.PARQUET_2_0) + .withWriteMode(ParquetFileWriter.Mode.OVERWRITE) + .build() + OdcVmResourceStateTableWriter(writer) + } + TABLE_INTERFERENCE_GROUPS -> { + val generator = jsonFactory.createGenerator(path.resolve("interference-model.json").toFile(), JsonEncoding.UTF8) + OdcVmInterferenceJsonTableWriter(generator) + } + else -> throw IllegalArgumentException("Table $table not supported") + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/Resource.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/Resource.kt new file mode 100644 index 00000000..e8efe60f --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/Resource.kt @@ -0,0 +1,37 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc.parquet + +import java.time.Instant + +/** + * A description of a resource in a trace. + */ +internal data class Resource( + val id: String, + val startTime: Instant, + val stopTime: Instant, + val cpuCount: Int, + val cpuCapacity: Double, + val memCapacity: Double, +) diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceReadSupport.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceReadSupport.kt new file mode 100644 index 00000000..75238344 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceReadSupport.kt @@ -0,0 +1,159 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc.parquet + +import org.apache.hadoop.conf.Configuration +import org.apache.parquet.hadoop.api.InitContext +import org.apache.parquet.hadoop.api.ReadSupport +import org.apache.parquet.io.api.RecordMaterializer +import org.apache.parquet.schema.LogicalTypeAnnotation +import org.apache.parquet.schema.MessageType +import org.apache.parquet.schema.PrimitiveType +import org.apache.parquet.schema.Types +import org.opendc.trace.TableColumn +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStartTime +import org.opendc.trace.conv.resourceStopTime + +/** + * A [ReadSupport] instance for [Resource] objects. + */ +internal class ResourceReadSupport(private val projection: List?) : ReadSupport() { + /** + * Mapping from field names to [TableColumn]s. + */ + private val fieldMap = + mapOf( + "id" to resourceID, + "submissionTime" to resourceStartTime, + "start_time" to resourceStartTime, + "endTime" to resourceStopTime, + "stop_time" to resourceStopTime, + "maxCores" to resourceCpuCount, + "cpu_count" to resourceCpuCount, + "cpu_capacity" to resourceCpuCapacity, + "requiredMemory" to resourceMemCapacity, + "mem_capacity" to resourceMemCapacity, + ) + + override fun init(context: InitContext): ReadContext { + val projectedSchema = + if (projection != null) { + Types.buildMessage() + .apply { + val projectionSet = projection.toSet() + + for (field in READ_SCHEMA.fields) { + val col = fieldMap[field.name] ?: continue + if (col in projectionSet) { + addField(field) + } + } + } + .named(READ_SCHEMA.name) + } else { + READ_SCHEMA + } + + return ReadContext(projectedSchema) + } + + override fun prepareForRead( + configuration: Configuration, + keyValueMetaData: Map, + fileSchema: MessageType, + readContext: ReadContext, + ): RecordMaterializer = ResourceRecordMaterializer(readContext.requestedSchema) + + companion object { + /** + * Parquet read schema (version 2.0) for the "resources" table in the trace. + */ + @JvmStatic + val READ_SCHEMA_V2_0: MessageType = + Types.buildMessage() + .addFields( + Types + .required(PrimitiveType.PrimitiveTypeName.BINARY) + .`as`(LogicalTypeAnnotation.stringType()) + .named("id"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("submissionTime"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("endTime"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT32) + .named("maxCores"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .named("requiredMemory"), + ) + .named("resource") + + /** + * Parquet read schema (version 2.1) for the "resources" table in the trace. + */ + @JvmStatic + val READ_SCHEMA_V2_1: MessageType = + Types.buildMessage() + .addFields( + Types + .required(PrimitiveType.PrimitiveTypeName.BINARY) + .`as`(LogicalTypeAnnotation.stringType()) + .named("id"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("start_time"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("stop_time"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT32) + .named("cpu_count"), + Types + .required(PrimitiveType.PrimitiveTypeName.DOUBLE) + .named("cpu_capacity"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .named("mem_capacity"), + ) + .named("resource") + + /** + * Parquet read schema for the "resources" table in the trace. + */ + @JvmStatic + val READ_SCHEMA: MessageType = + READ_SCHEMA_V2_0 + .union(READ_SCHEMA_V2_1) + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceRecordMaterializer.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceRecordMaterializer.kt new file mode 100644 index 00000000..2e32c2e2 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceRecordMaterializer.kt @@ -0,0 +1,127 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc.parquet + +import org.apache.parquet.io.api.Binary +import org.apache.parquet.io.api.Converter +import org.apache.parquet.io.api.GroupConverter +import org.apache.parquet.io.api.PrimitiveConverter +import org.apache.parquet.io.api.RecordMaterializer +import org.apache.parquet.schema.MessageType +import java.time.Instant + +/** + * A [RecordMaterializer] for [Resource] records. + */ +internal class ResourceRecordMaterializer(schema: MessageType) : RecordMaterializer() { + /** + * State of current record being read. + */ + private var localId = "" + private var localStartTime = Instant.MIN + private var localStopTime = Instant.MIN + private var localCpuCount = 0 + private var localCpuCapacity = 0.0 + private var localMemCapacity = 0.0 + + /** + * Root converter for the record. + */ + private val root = + object : GroupConverter() { + /** + * The converters for the columns of the schema. + */ + private val converters = + schema.fields.map { type -> + when (type.name) { + "id" -> + object : PrimitiveConverter() { + override fun addBinary(value: Binary) { + localId = value.toStringUsingUTF8() + } + } + "start_time", "submissionTime" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localStartTime = Instant.ofEpochMilli(value) + } + } + "stop_time", "endTime" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localStopTime = Instant.ofEpochMilli(value) + } + } + "cpu_count", "maxCores" -> + object : PrimitiveConverter() { + override fun addInt(value: Int) { + localCpuCount = value + } + } + "cpu_capacity" -> + object : PrimitiveConverter() { + override fun addDouble(value: Double) { + localCpuCapacity = value + } + } + "mem_capacity", "requiredMemory" -> + object : PrimitiveConverter() { + override fun addDouble(value: Double) { + localMemCapacity = value + } + + override fun addLong(value: Long) { + localMemCapacity = value.toDouble() + } + } + else -> error("Unknown column $type") + } + } + + override fun start() { + localId = "" + localStartTime = Instant.MIN + localStopTime = Instant.MIN + localCpuCount = 0 + localCpuCapacity = 0.0 + localMemCapacity = 0.0 + } + + override fun end() {} + + override fun getConverter(fieldIndex: Int): Converter = converters[fieldIndex] + } + + override fun getCurrentRecord(): Resource = + Resource( + localId, + localStartTime, + localStopTime, + localCpuCount, + localCpuCapacity, + localMemCapacity, + ) + + override fun getRootConverter(): GroupConverter = root +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceState.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceState.kt new file mode 100644 index 00000000..64ab9dca --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceState.kt @@ -0,0 +1,34 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc.parquet + +import java.time.Duration +import java.time.Instant + +internal class ResourceState( + val id: String, + val timestamp: Instant, + val duration: Duration, + val cpuCount: Int, + val cpuUsage: Double, +) diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateReadSupport.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateReadSupport.kt new file mode 100644 index 00000000..e7d35630 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateReadSupport.kt @@ -0,0 +1,149 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc.parquet + +import org.apache.hadoop.conf.Configuration +import org.apache.parquet.hadoop.api.InitContext +import org.apache.parquet.hadoop.api.ReadSupport +import org.apache.parquet.io.api.RecordMaterializer +import org.apache.parquet.schema.LogicalTypeAnnotation +import org.apache.parquet.schema.MessageType +import org.apache.parquet.schema.PrimitiveType +import org.apache.parquet.schema.Types +import org.opendc.trace.TableColumn +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateDuration +import org.opendc.trace.conv.resourceStateTimestamp + +/** + * A [ReadSupport] instance for [ResourceState] objects. + */ +internal class ResourceStateReadSupport(private val projection: List?) : ReadSupport() { + /** + * Mapping from field names to [TableColumn]s. + */ + private val fieldMap = + mapOf( + "id" to resourceID, + "time" to resourceStateTimestamp, + "timestamp" to resourceStateTimestamp, + "duration" to resourceStateDuration, + "cores" to resourceCpuCount, + "cpu_count" to resourceCpuCount, + "cpuUsage" to resourceStateCpuUsage, + "cpu_usage" to resourceStateCpuUsage, + ) + + override fun init(context: InitContext): ReadContext { + val projectedSchema = + if (projection != null) { + Types.buildMessage() + .apply { + val projectionSet = projection.toSet() + + for (field in READ_SCHEMA.fields) { + val col = fieldMap[field.name] ?: continue + if (col in projectionSet) { + addField(field) + } + } + } + .named(READ_SCHEMA.name) + } else { + READ_SCHEMA + } + + return ReadContext(projectedSchema) + } + + override fun prepareForRead( + configuration: Configuration, + keyValueMetaData: Map, + fileSchema: MessageType, + readContext: ReadContext, + ): RecordMaterializer = ResourceStateRecordMaterializer(readContext.requestedSchema) + + companion object { + /** + * Parquet read schema (version 2.0) for the "resource states" table in the trace. + */ + @JvmStatic + val READ_SCHEMA_V2_0: MessageType = + Types.buildMessage() + .addFields( + Types + .required(PrimitiveType.PrimitiveTypeName.BINARY) + .`as`(LogicalTypeAnnotation.stringType()) + .named("id"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("time"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .named("duration"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT32) + .named("cores"), + Types + .required(PrimitiveType.PrimitiveTypeName.DOUBLE) + .named("cpuUsage"), + ) + .named("resource_state") + + /** + * Parquet read schema (version 2.1) for the "resource states" table in the trace. + */ + @JvmStatic + val READ_SCHEMA_V2_1: MessageType = + Types.buildMessage() + .addFields( + Types + .required(PrimitiveType.PrimitiveTypeName.BINARY) + .`as`(LogicalTypeAnnotation.stringType()) + .named("id"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("timestamp"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .named("duration"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT32) + .named("cpu_count"), + Types + .required(PrimitiveType.PrimitiveTypeName.DOUBLE) + .named("cpu_usage"), + ) + .named("resource_state") + + /** + * Parquet read schema for the "resource states" table in the trace. + */ + @JvmStatic + val READ_SCHEMA: MessageType = READ_SCHEMA_V2_0.union(READ_SCHEMA_V2_1) + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateRecordMaterializer.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateRecordMaterializer.kt new file mode 100644 index 00000000..8ff0e476 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateRecordMaterializer.kt @@ -0,0 +1,114 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc.parquet + +import org.apache.parquet.io.api.Binary +import org.apache.parquet.io.api.Converter +import org.apache.parquet.io.api.GroupConverter +import org.apache.parquet.io.api.PrimitiveConverter +import org.apache.parquet.io.api.RecordMaterializer +import org.apache.parquet.schema.MessageType +import java.time.Duration +import java.time.Instant + +/** + * A [RecordMaterializer] for [ResourceState] records. + */ +internal class ResourceStateRecordMaterializer(schema: MessageType) : RecordMaterializer() { + /** + * State of current record being read. + */ + private var localId = "" + private var localTimestamp = Instant.MIN + private var localDuration = Duration.ZERO + private var localCpuCount = 0 + private var localCpuUsage = 0.0 + + /** + * Root converter for the record. + */ + private val root = + object : GroupConverter() { + /** + * The converters for the columns of the schema. + */ + private val converters = + schema.fields.map { type -> + when (type.name) { + "id" -> + object : PrimitiveConverter() { + override fun addBinary(value: Binary) { + localId = value.toStringUsingUTF8() + } + } + "timestamp", "time" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localTimestamp = Instant.ofEpochMilli(value) + } + } + "duration" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localDuration = Duration.ofMillis(value) + } + } + "cpu_count", "cores" -> + object : PrimitiveConverter() { + override fun addInt(value: Int) { + localCpuCount = value + } + } + "cpu_usage", "cpuUsage" -> + object : PrimitiveConverter() { + override fun addDouble(value: Double) { + localCpuUsage = value + } + } + "flops" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + // Ignore to support v1 format + } + } + else -> error("Unknown column $type") + } + } + + override fun start() { + localId = "" + localTimestamp = Instant.MIN + localDuration = Duration.ZERO + localCpuCount = 0 + localCpuUsage = 0.0 + } + + override fun end() {} + + override fun getConverter(fieldIndex: Int): Converter = converters[fieldIndex] + } + + override fun getCurrentRecord(): ResourceState = ResourceState(localId, localTimestamp, localDuration, localCpuCount, localCpuUsage) + + override fun getRootConverter(): GroupConverter = root +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateWriteSupport.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateWriteSupport.kt new file mode 100644 index 00000000..58c43916 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceStateWriteSupport.kt @@ -0,0 +1,112 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc.parquet + +import org.apache.hadoop.conf.Configuration +import org.apache.parquet.hadoop.api.WriteSupport +import org.apache.parquet.io.api.Binary +import org.apache.parquet.io.api.RecordConsumer +import org.apache.parquet.schema.LogicalTypeAnnotation +import org.apache.parquet.schema.MessageType +import org.apache.parquet.schema.PrimitiveType +import org.apache.parquet.schema.Types + +/** + * Support for writing [Resource] instances to Parquet format. + */ +internal class ResourceStateWriteSupport : WriteSupport() { + /** + * The current active record consumer. + */ + private lateinit var recordConsumer: RecordConsumer + + override fun init(configuration: Configuration): WriteContext { + return WriteContext(WRITE_SCHEMA, emptyMap()) + } + + override fun prepareForWrite(recordConsumer: RecordConsumer) { + this.recordConsumer = recordConsumer + } + + override fun write(record: ResourceState) { + write(recordConsumer, record) + } + + private fun write( + consumer: RecordConsumer, + record: ResourceState, + ) { + consumer.startMessage() + + consumer.startField("id", 0) + consumer.addBinary(Binary.fromCharSequence(record.id)) + consumer.endField("id", 0) + + consumer.startField("timestamp", 1) + consumer.addLong(record.timestamp.toEpochMilli()) + consumer.endField("timestamp", 1) + + consumer.startField("duration", 2) + consumer.addLong(record.duration.toMillis()) + consumer.endField("duration", 2) + + consumer.startField("cpu_count", 3) + consumer.addInteger(record.cpuCount) + consumer.endField("cpu_count", 3) + + consumer.startField("cpu_usage", 4) + consumer.addDouble(record.cpuUsage) + consumer.endField("cpu_usage", 4) + + consumer.endMessage() + } + + companion object { + /** + * Parquet schema for the "resource states" table in the trace. + */ + @JvmStatic + val WRITE_SCHEMA: MessageType = + Types.buildMessage() + .addFields( + Types + .required(PrimitiveType.PrimitiveTypeName.BINARY) + .`as`(LogicalTypeAnnotation.stringType()) + .named("id"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("timestamp"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .named("duration"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT32) + .named("cpu_count"), + Types + .required(PrimitiveType.PrimitiveTypeName.DOUBLE) + .named("cpu_usage"), + ) + .named("resource_state") + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceWriteSupport.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceWriteSupport.kt new file mode 100644 index 00000000..a9937ffd --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/opendc/parquet/ResourceWriteSupport.kt @@ -0,0 +1,121 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.formats.opendc.parquet + +import org.apache.hadoop.conf.Configuration +import org.apache.parquet.hadoop.api.WriteSupport +import org.apache.parquet.io.api.Binary +import org.apache.parquet.io.api.RecordConsumer +import org.apache.parquet.schema.LogicalTypeAnnotation +import org.apache.parquet.schema.MessageType +import org.apache.parquet.schema.PrimitiveType +import org.apache.parquet.schema.Types +import kotlin.math.roundToLong + +/** + * Support for writing [Resource] instances to Parquet format. + */ +internal class ResourceWriteSupport : WriteSupport() { + /** + * The current active record consumer. + */ + private lateinit var recordConsumer: RecordConsumer + + override fun init(configuration: Configuration): WriteContext { + return WriteContext(WRITE_SCHEMA, emptyMap()) + } + + override fun prepareForWrite(recordConsumer: RecordConsumer) { + this.recordConsumer = recordConsumer + } + + override fun write(record: Resource) { + write(recordConsumer, record) + } + + private fun write( + consumer: RecordConsumer, + record: Resource, + ) { + consumer.startMessage() + + consumer.startField("id", 0) + consumer.addBinary(Binary.fromCharSequence(record.id)) + consumer.endField("id", 0) + + consumer.startField("start_time", 1) + consumer.addLong(record.startTime.toEpochMilli()) + consumer.endField("start_time", 1) + + consumer.startField("stop_time", 2) + consumer.addLong(record.stopTime.toEpochMilli()) + consumer.endField("stop_time", 2) + + consumer.startField("cpu_count", 3) + consumer.addInteger(record.cpuCount) + consumer.endField("cpu_count", 3) + + consumer.startField("cpu_capacity", 4) + consumer.addDouble(record.cpuCapacity) + consumer.endField("cpu_capacity", 4) + + consumer.startField("mem_capacity", 5) + consumer.addLong(record.memCapacity.roundToLong()) + consumer.endField("mem_capacity", 5) + + consumer.endMessage() + } + + companion object { + /** + * Parquet schema for the "resources" table in the trace. + */ + @JvmStatic + val WRITE_SCHEMA: MessageType = + Types.buildMessage() + .addFields( + Types + .required(PrimitiveType.PrimitiveTypeName.BINARY) + .`as`(LogicalTypeAnnotation.stringType()) + .named("id"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("start_time"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("stop_time"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT32) + .named("cpu_count"), + Types + .required(PrimitiveType.PrimitiveTypeName.DOUBLE) + .named("cpu_capacity"), + Types + .required(PrimitiveType.PrimitiveTypeName.INT64) + .named("mem_capacity"), + ) + .named("resource") + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/swf/SwfTaskTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/swf/SwfTaskTableReader.kt new file mode 100644 index 00000000..5a79fd6f --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/swf/SwfTaskTableReader.kt @@ -0,0 +1,236 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.swf + +import org.opendc.trace.TableReader +import org.opendc.trace.conv.TASK_ALLOC_NCPUS +import org.opendc.trace.conv.TASK_GROUP_ID +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_STATUS +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_USER_ID +import org.opendc.trace.conv.TASK_WAIT_TIME +import java.io.BufferedReader +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] implementation for the SWF format. + */ +internal class SwfTaskTableReader(private val reader: BufferedReader) : TableReader { + /** + * A flag to indicate the state of the reader + */ + private var state = State.Pending + + /** + * The current row. + */ + private var fields = emptyList() + + /** + * A [Regex] object to match whitespace. + */ + private val whitespace = "\\s+".toRegex() + + override fun nextRow(): Boolean { + var line: String? + var num = 0 + + val state = state + if (state == State.Closed) { + return false + } else if (state == State.Pending) { + this.state = State.Active + } + + while (true) { + line = reader.readLine() + + if (line == null) { + this.state = State.Closed + return false + } + num++ + + if (line.isBlank()) { + // Ignore empty lines + continue + } else if (line.startsWith(";")) { + // Ignore comments for now + continue + } + + break + } + + fields = line!!.trim().split(whitespace) + + if (fields.size < 18) { + throw IllegalArgumentException("Invalid format at line $line") + } + + return true + } + + override fun resolve(name: String): Int { + return when (name) { + TASK_ID -> colJobID + TASK_SUBMIT_TIME -> colSubmitTime + TASK_WAIT_TIME -> colWaitTime + TASK_RUNTIME -> colRunTime + TASK_ALLOC_NCPUS -> colAllocNcpus + TASK_REQ_NCPUS -> colReqNcpus + TASK_STATUS -> colStatus + TASK_USER_ID -> colUserID + TASK_GROUP_ID -> colGroupID + TASK_PARENTS -> colParentJob + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in colJobID..colParentThinkTime) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + check(state == State.Active) { "No active row" } + return when (index) { + colReqNcpus, colAllocNcpus, colStatus, colGroupID, colUserID -> fields[index].toInt(10) + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + throw IllegalArgumentException("Invalid column") + } + + override fun getString(index: Int): String { + check(state == State.Active) { "No active row" } + return when (index) { + colJobID -> fields[index] + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant? { + check(state == State.Active) { "No active row" } + return when (index) { + colSubmitTime -> Instant.ofEpochSecond(fields[index].toLong(10)) + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getDuration(index: Int): Duration? { + check(state == State.Active) { "No active row" } + return when (index) { + colWaitTime, colRunTime -> Duration.ofSeconds(fields[index].toLong(10)) + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + check(state == State.Active) { "No active row" } + @Suppress("UNCHECKED_CAST") + return when (index) { + colParentJob -> { + require(elementType.isAssignableFrom(String::class.java)) + val parent = fields[index].toLong(10) + if (parent < 0) emptySet() else setOf(parent) + } + else -> throw IllegalArgumentException("Invalid column") + } as Set? + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + reader.close() + state = State.Closed + } + + /** + * Default column indices for the SWF format. + */ + private val colJobID = 0 + private val colSubmitTime = 1 + private val colWaitTime = 2 + private val colRunTime = 3 + private val colAllocNcpus = 4 + private val colAvgCpuTime = 5 + private val colUsedMem = 6 + private val colReqNcpus = 7 + private val colReqTime = 8 + private val colReqMem = 9 + private val colStatus = 10 + private val colUserID = 11 + private val colGroupID = 12 + private val colExecNum = 13 + private val colQueueNum = 14 + private val colPartNum = 15 + private val colParentJob = 16 + private val colParentThinkTime = 17 + + private enum class State { + Pending, + Active, + Closed, + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/swf/SwfTraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/swf/SwfTraceFormat.kt new file mode 100644 index 00000000..d59b07b4 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/swf/SwfTraceFormat.kt @@ -0,0 +1,100 @@ +/* + * Copyright (c) 2020 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.swf + +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.TABLE_TASKS +import org.opendc.trace.conv.TASK_ALLOC_NCPUS +import org.opendc.trace.conv.TASK_GROUP_ID +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_STATUS +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_USER_ID +import org.opendc.trace.conv.TASK_WAIT_TIME +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import java.nio.file.Path +import kotlin.io.path.bufferedReader + +/** + * Support for the Standard Workload Format (SWF) in OpenDC. + * + * The standard is defined by the PWA, see here: https://www.cse.huji.ac.il/labs/parallel/workload/swf.html + */ +public class SwfTraceFormat : TraceFormat { + override val name: String = "swf" + + override fun create(path: Path) { + throw UnsupportedOperationException("Writing not supported for this format") + } + + override fun getTables(path: Path): List = listOf(TABLE_TASKS) + + override fun getDetails( + path: Path, + table: String, + ): TableDetails { + return when (table) { + TABLE_TASKS -> + TableDetails( + listOf( + TableColumn(TASK_ID, TableColumnType.String), + TableColumn(TASK_SUBMIT_TIME, TableColumnType.Instant), + TableColumn(TASK_WAIT_TIME, TableColumnType.Duration), + TableColumn(TASK_RUNTIME, TableColumnType.Duration), + TableColumn(TASK_REQ_NCPUS, TableColumnType.Int), + TableColumn(TASK_ALLOC_NCPUS, TableColumnType.Int), + TableColumn(TASK_PARENTS, TableColumnType.Set(TableColumnType.String)), + TableColumn(TASK_STATUS, TableColumnType.Int), + TableColumn(TASK_GROUP_ID, TableColumnType.Int), + TableColumn(TASK_USER_ID, TableColumnType.Int), + ), + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader( + path: Path, + table: String, + projection: List?, + ): TableReader { + return when (table) { + TABLE_TASKS -> SwfTaskTableReader(path.bufferedReader()) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter( + path: Path, + table: String, + ): TableWriter { + throw UnsupportedOperationException("Writing not supported for this format") + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wfformat/WfFormatTaskTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wfformat/WfFormatTaskTableReader.kt new file mode 100644 index 00000000..8f84e51f --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wfformat/WfFormatTaskTableReader.kt @@ -0,0 +1,314 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wfformat + +import com.fasterxml.jackson.core.JsonParseException +import com.fasterxml.jackson.core.JsonParser +import com.fasterxml.jackson.core.JsonToken +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.conv.TASK_CHILDREN +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import org.opendc.trace.util.convertTo +import java.time.Duration +import java.time.Instant +import java.util.UUID +import kotlin.math.roundToInt + +/** + * A [TableReader] implementation for the WfCommons workload trace format. + */ +internal class WfFormatTaskTableReader(private val parser: JsonParser) : TableReader { + /** + * The current nesting of the parser. + */ + private var level: ParserLevel = ParserLevel.TOP + + override fun nextRow(): Boolean { + reset() + + var hasJob = false + + while (!hasJob) { + when (level) { + ParserLevel.TOP -> { + val token = parser.nextToken() + + // Check whether the document is not empty and starts with an object + if (token == null) { + parser.close() + break + } else if (token != JsonToken.START_OBJECT) { + throw JsonParseException(parser, "Expected object", parser.currentLocation) + } else { + level = ParserLevel.TRACE + } + } + ParserLevel.TRACE -> { + // Seek for the workflow object in the file + if (!seekWorkflow()) { + parser.close() + break + } else if (!parser.isExpectedStartObjectToken) { + throw JsonParseException(parser, "Expected object", parser.currentLocation) + } else { + level = ParserLevel.WORKFLOW + } + } + ParserLevel.WORKFLOW -> { + // Seek for the jobs object in the file + level = + if (!seekJobs()) { + ParserLevel.TRACE + } else if (!parser.isExpectedStartArrayToken) { + throw JsonParseException(parser, "Expected array", parser.currentLocation) + } else { + ParserLevel.JOB + } + } + ParserLevel.JOB -> { + when (parser.nextToken()) { + JsonToken.END_ARRAY -> level = ParserLevel.WORKFLOW + JsonToken.START_OBJECT -> { + parseJob() + hasJob = true + break + } + else -> throw JsonParseException(parser, "Unexpected token", parser.currentLocation) + } + } + } + } + + return hasJob + } + + override fun resolve(name: String): Int { + return when (name) { + TASK_ID -> colID + TASK_WORKFLOW_ID -> colWorkflowID + TASK_RUNTIME -> colRuntime + TASK_REQ_NCPUS -> colNproc + TASK_PARENTS -> colParents + TASK_CHILDREN -> colChildren + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in 0..colChildren) { "Invalid column value" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + checkActive() + return when (index) { + colNproc -> cores + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + throw IllegalArgumentException("Invalid column") + } + + override fun getString(index: Int): String? { + checkActive() + return when (index) { + colID -> id + colWorkflowID -> workflowId + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant? { + throw IllegalArgumentException("Invalid column") + } + + override fun getDuration(index: Int): Duration? { + checkActive() + return when (index) { + colRuntime -> runtime + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + checkActive() + return when (index) { + colParents -> typeParents.convertTo(parents, elementType) + colChildren -> typeChildren.convertTo(children, elementType) + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + parser.close() + } + + /** + * Helper method to check if the reader is active. + */ + private fun checkActive() { + check(level != ParserLevel.TOP && !parser.isClosed) { "No active row. Did you call nextRow()?" } + } + + /** + * Parse the trace and seek until the workflow description. + */ + private fun seekWorkflow(): Boolean { + while (parser.nextValue() != JsonToken.END_OBJECT && !parser.isClosed) { + when (parser.currentName) { + "name" -> workflowId = parser.text + "workflow" -> return true + else -> parser.skipChildren() + } + } + + return false + } + + /** + * Parse the workflow description in the file and seek until the first job. + */ + private fun seekJobs(): Boolean { + while (parser.nextValue() != JsonToken.END_OBJECT) { + when (parser.currentName) { + "jobs" -> return true + else -> parser.skipChildren() + } + } + + return false + } + + /** + * Parse a single job in the file. + */ + private fun parseJob() { + while (parser.nextValue() != JsonToken.END_OBJECT) { + when (parser.currentName) { + "name" -> id = parser.text + "parents" -> parents = parseIds() + "children" -> children = parseIds() + "runtime" -> runtime = Duration.ofSeconds(parser.numberValue.toLong()) + "cores" -> cores = parser.floatValue.roundToInt() + else -> parser.skipChildren() + } + } + } + + /** + * Parse the parents/children of a job. + */ + private fun parseIds(): Set { + if (!parser.isExpectedStartArrayToken) { + throw JsonParseException(parser, "Expected array", parser.currentLocation) + } + + val ids = mutableSetOf() + + while (parser.nextToken() != JsonToken.END_ARRAY) { + if (parser.currentToken != JsonToken.VALUE_STRING) { + throw JsonParseException(parser, "Expected token", parser.currentLocation) + } + + ids.add(parser.valueAsString) + } + + return ids + } + + private enum class ParserLevel { + TOP, + TRACE, + WORKFLOW, + JOB, + } + + /** + * State fields for the parser. + */ + private var id: String? = null + private var workflowId: String? = null + private var runtime: Duration? = null + private var parents: Set? = null + private var children: Set? = null + private var cores = -1 + + private fun reset() { + id = null + runtime = null + parents = null + children = null + cores = -1 + } + + private val colID = 0 + private val colWorkflowID = 1 + private val colRuntime = 3 + private val colNproc = 4 + private val colParents = 5 + private val colChildren = 6 + + private val typeParents = TableColumnType.Set(TableColumnType.String) + private val typeChildren = TableColumnType.Set(TableColumnType.String) +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wfformat/WfFormatTraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wfformat/WfFormatTraceFormat.kt new file mode 100644 index 00000000..2178fac6 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wfformat/WfFormatTraceFormat.kt @@ -0,0 +1,95 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wfformat + +import com.fasterxml.jackson.core.JsonFactory +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.TABLE_TASKS +import org.opendc.trace.conv.TASK_CHILDREN +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import java.nio.file.Path + +/** + * A [TraceFormat] implementation for the WfCommons workload trace format. + */ +public class WfFormatTraceFormat : TraceFormat { + /** + * The [JsonFactory] that is used to created JSON parsers. + */ + private val factory = JsonFactory() + + override val name: String = "wfformat" + + override fun create(path: Path) { + throw UnsupportedOperationException("Writing not supported for this format") + } + + override fun getTables(path: Path): List = listOf(TABLE_TASKS) + + override fun getDetails( + path: Path, + table: String, + ): TableDetails { + return when (table) { + TABLE_TASKS -> + TableDetails( + listOf( + TableColumn(TASK_ID, TableColumnType.String), + TableColumn(TASK_WORKFLOW_ID, TableColumnType.String), + TableColumn(TASK_RUNTIME, TableColumnType.Duration), + TableColumn(TASK_REQ_NCPUS, TableColumnType.Int), + TableColumn(TASK_PARENTS, TableColumnType.Set(TableColumnType.String)), + TableColumn(TASK_CHILDREN, TableColumnType.Set(TableColumnType.String)), + ), + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader( + path: Path, + table: String, + projection: List?, + ): TableReader { + return when (table) { + TABLE_TASKS -> WfFormatTaskTableReader(factory.createParser(path.toFile())) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter( + path: Path, + table: String, + ): TableWriter { + throw UnsupportedOperationException("Writing not supported for this format") + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/WtfTaskTableReader.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/WtfTaskTableReader.kt new file mode 100644 index 00000000..95582388 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/WtfTaskTableReader.kt @@ -0,0 +1,187 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wtf + +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.conv.TASK_CHILDREN +import org.opendc.trace.conv.TASK_GROUP_ID +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_USER_ID +import org.opendc.trace.conv.TASK_WAIT_TIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import org.opendc.trace.util.convertTo +import org.opendc.trace.util.parquet.LocalParquetReader +import org.opendc.trace.wtf.parquet.Task +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A [TableReader] implementation for the WTF format. + */ +internal class WtfTaskTableReader(private val reader: LocalParquetReader) : TableReader { + /** + * The current record. + */ + private var record: Task? = null + + override fun nextRow(): Boolean { + try { + val record = reader.read() + this.record = record + + return record != null + } catch (e: Throwable) { + this.record = null + throw e + } + } + + private val colID = 0 + private val colWorkflowID = 1 + private val colSubmitTime = 2 + private val colWaitTime = 3 + private val colRuntime = 4 + private val colReqNcpus = 5 + private val colParents = 6 + private val colChildren = 7 + private val colGroupID = 8 + private val colUserID = 9 + + private val typeParents = TableColumnType.Set(TableColumnType.String) + private val typeChildren = TableColumnType.Set(TableColumnType.String) + + override fun resolve(name: String): Int { + return when (name) { + TASK_ID -> colID + TASK_WORKFLOW_ID -> colWorkflowID + TASK_SUBMIT_TIME -> colSubmitTime + TASK_WAIT_TIME -> colWaitTime + TASK_RUNTIME -> colRuntime + TASK_REQ_NCPUS -> colReqNcpus + TASK_PARENTS -> colParents + TASK_CHILDREN -> colChildren + TASK_GROUP_ID -> colGroupID + TASK_USER_ID -> colUserID + else -> -1 + } + } + + override fun isNull(index: Int): Boolean { + require(index in colID..colUserID) { "Invalid column index" } + return false + } + + override fun getBoolean(index: Int): Boolean { + throw IllegalArgumentException("Invalid column") + } + + override fun getInt(index: Int): Int { + val record = checkNotNull(record) { "Reader in invalid state" } + + return when (index) { + colReqNcpus -> record.requestedCpus + colGroupID -> record.groupId + colUserID -> record.userId + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getLong(index: Int): Long { + throw IllegalArgumentException("Invalid column") + } + + override fun getFloat(index: Int): Float { + throw IllegalArgumentException("Invalid column") + } + + override fun getDouble(index: Int): Double { + throw IllegalArgumentException("Invalid column") + } + + override fun getString(index: Int): String { + val record = checkNotNull(record) { "Reader in invalid state" } + return when (index) { + colID -> record.id + colWorkflowID -> record.workflowId + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getUUID(index: Int): UUID? { + throw IllegalArgumentException("Invalid column") + } + + override fun getInstant(index: Int): Instant { + val record = checkNotNull(record) { "Reader in invalid state" } + return when (index) { + colSubmitTime -> record.submitTime + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getDuration(index: Int): Duration { + val record = checkNotNull(record) { "Reader in invalid state" } + return when (index) { + colWaitTime -> record.waitTime + colRuntime -> record.runtime + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getList( + index: Int, + elementType: Class, + ): List? { + throw IllegalArgumentException("Invalid column") + } + + override fun getSet( + index: Int, + elementType: Class, + ): Set? { + val record = checkNotNull(record) { "Reader in invalid state" } + return when (index) { + colParents -> typeParents.convertTo(record.parents, elementType) + colChildren -> typeChildren.convertTo(record.children, elementType) + else -> throw IllegalArgumentException("Invalid column") + } + } + + override fun getMap( + index: Int, + keyType: Class, + valueType: Class, + ): Map? { + throw IllegalArgumentException("Invalid column") + } + + override fun close() { + reader.close() + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/WtfTraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/WtfTraceFormat.kt new file mode 100644 index 00000000..1386d2ef --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/WtfTraceFormat.kt @@ -0,0 +1,102 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wtf + +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.TABLE_TASKS +import org.opendc.trace.conv.TASK_CHILDREN +import org.opendc.trace.conv.TASK_GROUP_ID +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_USER_ID +import org.opendc.trace.conv.TASK_WAIT_TIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import org.opendc.trace.spi.TableDetails +import org.opendc.trace.spi.TraceFormat +import org.opendc.trace.util.parquet.LocalParquetReader +import org.opendc.trace.wtf.parquet.TaskReadSupport +import java.nio.file.Path + +/** + * A [TraceFormat] implementation for the Workflow Trace Format (WTF). + */ +public class WtfTraceFormat : TraceFormat { + override val name: String = "wtf" + + override fun create(path: Path) { + throw UnsupportedOperationException("Writing not supported for this format") + } + + override fun getTables(path: Path): List = listOf(TABLE_TASKS) + + override fun getDetails( + path: Path, + table: String, + ): TableDetails { + return when (table) { + TABLE_TASKS -> + TableDetails( + listOf( + TableColumn(TASK_ID, TableColumnType.String), + TableColumn(TASK_WORKFLOW_ID, TableColumnType.String), + TableColumn(TASK_SUBMIT_TIME, TableColumnType.Instant), + TableColumn(TASK_WAIT_TIME, TableColumnType.Duration), + TableColumn(TASK_RUNTIME, TableColumnType.Duration), + TableColumn(TASK_REQ_NCPUS, TableColumnType.Int), + TableColumn(TASK_PARENTS, TableColumnType.Set(TableColumnType.String)), + TableColumn(TASK_CHILDREN, TableColumnType.Set(TableColumnType.String)), + TableColumn(TASK_GROUP_ID, TableColumnType.Int), + TableColumn(TASK_USER_ID, TableColumnType.Int), + ), + ) + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newReader( + path: Path, + table: String, + projection: List?, + ): TableReader { + return when (table) { + TABLE_TASKS -> { + val reader = LocalParquetReader(path.resolve("tasks/schema-1.0"), TaskReadSupport(projection), strictTyping = false) + WtfTaskTableReader(reader) + } + else -> throw IllegalArgumentException("Table $table not supported") + } + } + + override fun newWriter( + path: Path, + table: String, + ): TableWriter { + throw UnsupportedOperationException("Writing not supported for this format") + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/Task.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/Task.kt new file mode 100644 index 00000000..a1db0cab --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/Task.kt @@ -0,0 +1,42 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wtf.parquet + +import java.time.Duration +import java.time.Instant + +/** + * A task in the Workflow Trace Format. + */ +internal data class Task( + val id: String, + val workflowId: String, + val submitTime: Instant, + val waitTime: Duration, + val runtime: Duration, + val requestedCpus: Int, + val groupId: Int, + val userId: Int, + val parents: Set, + val children: Set, +) diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/TaskReadSupport.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/TaskReadSupport.kt new file mode 100644 index 00000000..1f9c506d --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/TaskReadSupport.kt @@ -0,0 +1,148 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wtf.parquet + +import org.apache.hadoop.conf.Configuration +import org.apache.parquet.hadoop.api.InitContext +import org.apache.parquet.hadoop.api.ReadSupport +import org.apache.parquet.io.api.RecordMaterializer +import org.apache.parquet.schema.LogicalTypeAnnotation +import org.apache.parquet.schema.MessageType +import org.apache.parquet.schema.PrimitiveType +import org.apache.parquet.schema.Type +import org.apache.parquet.schema.Types +import org.opendc.trace.conv.TASK_CHILDREN +import org.opendc.trace.conv.TASK_GROUP_ID +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_REQ_NCPUS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_USER_ID +import org.opendc.trace.conv.TASK_WAIT_TIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID + +/** + * A [ReadSupport] instance for [Task] objects. + * + * @param projection The projection of the table to read. + */ +internal class TaskReadSupport(private val projection: List?) : ReadSupport() { + /** + * Mapping of table columns to their Parquet column names. + */ + private val colMap = + mapOf( + TASK_ID to "id", + TASK_WORKFLOW_ID to "workflow_id", + TASK_SUBMIT_TIME to "ts_submit", + TASK_WAIT_TIME to "wait_time", + TASK_RUNTIME to "runtime", + TASK_REQ_NCPUS to "resource_amount_requested", + TASK_PARENTS to "parents", + TASK_CHILDREN to "children", + TASK_GROUP_ID to "group_id", + TASK_USER_ID to "user_id", + ) + + override fun init(context: InitContext): ReadContext { + val projectedSchema = + if (projection != null) { + Types.buildMessage() + .apply { + val fieldByName = READ_SCHEMA.fields.associateBy { it.name } + + for (col in projection) { + val fieldName = colMap[col] ?: continue + addField(fieldByName.getValue(fieldName)) + } + } + .named(READ_SCHEMA.name) + } else { + READ_SCHEMA + } + return ReadContext(projectedSchema) + } + + override fun prepareForRead( + configuration: Configuration, + keyValueMetaData: Map, + fileSchema: MessageType, + readContext: ReadContext, + ): RecordMaterializer = TaskRecordMaterializer(readContext.requestedSchema) + + companion object { + /** + * Parquet read schema for the "tasks" table in the trace. + */ + @JvmStatic + val READ_SCHEMA: MessageType = + Types.buildMessage() + .addFields( + Types + .optional(PrimitiveType.PrimitiveTypeName.INT64) + .named("id"), + Types + .optional(PrimitiveType.PrimitiveTypeName.INT64) + .named("workflow_id"), + Types + .optional(PrimitiveType.PrimitiveTypeName.INT64) + .`as`(LogicalTypeAnnotation.timestampType(true, LogicalTypeAnnotation.TimeUnit.MILLIS)) + .named("ts_submit"), + Types + .optional(PrimitiveType.PrimitiveTypeName.INT64) + .named("wait_time"), + Types + .optional(PrimitiveType.PrimitiveTypeName.INT64) + .named("runtime"), + Types + .optional(PrimitiveType.PrimitiveTypeName.DOUBLE) + .named("resource_amount_requested"), + Types + .optional(PrimitiveType.PrimitiveTypeName.INT32) + .named("user_id"), + Types + .optional(PrimitiveType.PrimitiveTypeName.INT32) + .named("group_id"), + Types + .buildGroup(Type.Repetition.OPTIONAL) + .addField( + Types.repeatedGroup() + .addField(Types.optional(PrimitiveType.PrimitiveTypeName.INT64).named("item")) + .named("list"), + ) + .`as`(LogicalTypeAnnotation.listType()) + .named("children"), + Types + .buildGroup(Type.Repetition.OPTIONAL) + .addField( + Types.repeatedGroup() + .addField(Types.optional(PrimitiveType.PrimitiveTypeName.INT64).named("item")) + .named("list"), + ) + .`as`(LogicalTypeAnnotation.listType()) + .named("parents"), + ) + .named("task") + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/TaskRecordMaterializer.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/TaskRecordMaterializer.kt new file mode 100644 index 00000000..412a4f8b --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/formats/wtf/parquet/TaskRecordMaterializer.kt @@ -0,0 +1,188 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wtf.parquet + +import org.apache.parquet.io.api.Converter +import org.apache.parquet.io.api.GroupConverter +import org.apache.parquet.io.api.PrimitiveConverter +import org.apache.parquet.io.api.RecordMaterializer +import org.apache.parquet.schema.MessageType +import java.time.Duration +import java.time.Instant +import kotlin.math.roundToInt +import kotlin.math.roundToLong + +/** + * A [RecordMaterializer] for [Task] records. + */ +internal class TaskRecordMaterializer(schema: MessageType) : RecordMaterializer() { + /** + * State of current record being read. + */ + private var localID = "" + private var localWorkflowID = "" + private var localSubmitTime = Instant.MIN + private var localWaitTime = Duration.ZERO + private var localRuntime = Duration.ZERO + private var localRequestedCpus = 0 + private var localGroupId = 0 + private var localUserId = 0 + private var localParents = mutableSetOf() + private var localChildren = mutableSetOf() + + /** + * Root converter for the record. + */ + private val root = + object : GroupConverter() { + /** + * The converters for the columns of the schema. + */ + private val converters = + schema.fields.map { type -> + when (type.name) { + "id" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localID = value.toString() + } + } + "workflow_id" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localWorkflowID = value.toString() + } + } + "ts_submit" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localSubmitTime = Instant.ofEpochMilli(value) + } + } + "wait_time" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localWaitTime = Duration.ofMillis(value) + } + } + "runtime" -> + object : PrimitiveConverter() { + override fun addLong(value: Long) { + localRuntime = Duration.ofMillis(value) + } + } + "resource_amount_requested" -> + object : PrimitiveConverter() { + override fun addDouble(value: Double) { + localRequestedCpus = value.roundToInt() + } + } + "group_id" -> + object : PrimitiveConverter() { + override fun addInt(value: Int) { + localGroupId = value + } + } + "user_id" -> + object : PrimitiveConverter() { + override fun addInt(value: Int) { + localUserId = value + } + } + "children" -> RelationConverter(localChildren) + "parents" -> RelationConverter(localParents) + else -> error("Unknown column $type") + } + } + + override fun start() { + localID = "" + localWorkflowID = "" + localSubmitTime = Instant.MIN + localWaitTime = Duration.ZERO + localRuntime = Duration.ZERO + localRequestedCpus = 0 + localGroupId = 0 + localUserId = 0 + localParents.clear() + localChildren.clear() + } + + override fun end() {} + + override fun getConverter(fieldIndex: Int): Converter = converters[fieldIndex] + } + + override fun getCurrentRecord(): Task = + Task( + localID, + localWorkflowID, + localSubmitTime, + localWaitTime, + localRuntime, + localRequestedCpus, + localGroupId, + localUserId, + localParents.toSet(), + localChildren.toSet(), + ) + + override fun getRootConverter(): GroupConverter = root + + /** + * Helper class to convert parent and child relations and add them to [relations]. + */ + private class RelationConverter(private val relations: MutableSet) : GroupConverter() { + private val entryConverter = + object : PrimitiveConverter() { + override fun addLong(value: Long) { + relations.add(value.toString()) + } + + override fun addDouble(value: Double) { + relations.add(value.roundToLong().toString()) + } + } + + private val listConverter = + object : GroupConverter() { + override fun getConverter(fieldIndex: Int): Converter { + require(fieldIndex == 0) + return entryConverter + } + + override fun start() {} + + override fun end() {} + } + + override fun getConverter(fieldIndex: Int): Converter { + require(fieldIndex == 0) + return listConverter + } + + override fun start() {} + + override fun end() {} + } +} diff --git a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/spi/TraceFormat.kt b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/spi/TraceFormat.kt index 83537822..89cac608 100644 --- a/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/spi/TraceFormat.kt +++ b/opendc-trace/opendc-trace-api/src/main/kotlin/org/opendc/trace/spi/TraceFormat.kt @@ -24,6 +24,13 @@ package org.opendc.trace.spi import org.opendc.trace.TableReader import org.opendc.trace.TableWriter +import org.opendc.trace.azure.AzureTraceFormat +import org.opendc.trace.bitbrains.BitbrainsTraceFormat +import org.opendc.trace.formats.opendc.OdcVmTraceFormat +import org.opendc.trace.gwf.GwfTraceFormat +import org.opendc.trace.swf.SwfTraceFormat +import org.opendc.trace.wfformat.WfFormatTraceFormat +import org.opendc.trace.wtf.WtfTraceFormat import java.nio.file.Path import java.util.ServiceLoader @@ -107,13 +114,31 @@ public interface TraceFormat { return ServiceLoader.load(TraceFormat::class.java) } +// /** +// * Obtain a [TraceFormat] implementation by [name]. +// */ +// @JvmStatic +// public fun byName(name: String): TraceFormat? { +// +// val loader = ServiceLoader.load(TraceFormat::class.java) +// return loader.find { it.name == name } +// } + /** * Obtain a [TraceFormat] implementation by [name]. */ @JvmStatic public fun byName(name: String): TraceFormat? { - val loader = ServiceLoader.load(TraceFormat::class.java) - return loader.find { it.name == name } + return when (name) { + "opendc-vm" -> OdcVmTraceFormat() + "azure" -> AzureTraceFormat() + "bitbrains" -> BitbrainsTraceFormat() + "gwf" -> GwfTraceFormat() + "swf" -> SwfTraceFormat() + "wfformat" -> WfFormatTraceFormat() + "wtf" -> WtfTraceFormat() + else -> null + } } } } diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/azure/AzureTraceFormatTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/azure/AzureTraceFormatTest.kt new file mode 100644 index 00000000..40df36c6 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/azure/AzureTraceFormatTest.kt @@ -0,0 +1,132 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.azure + +import formats.wtf.TableReaderTestKit +import org.junit.jupiter.api.Assertions.assertAll +import org.junit.jupiter.api.Assertions.assertDoesNotThrow +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.BeforeEach +import org.junit.jupiter.api.DisplayName +import org.junit.jupiter.api.Nested +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableReader +import org.opendc.trace.azure.AzureTraceFormat +import org.opendc.trace.conv.TABLE_RESOURCES +import org.opendc.trace.conv.TABLE_RESOURCE_STATES +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStateCpuUsagePct +import org.opendc.trace.conv.resourceStateTimestamp +import java.nio.file.Paths + +/** + * Test suite for the [AzureTraceFormat] class. + */ +@DisplayName("Azure VM TraceFormat") +class AzureTraceFormatTest { + private val format = AzureTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/azure/trace") + + assertEquals(listOf(TABLE_RESOURCES, TABLE_RESOURCE_STATES), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/azure/trace") + + assertDoesNotThrow { format.getDetails(path, TABLE_RESOURCE_STATES) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/azure/trace") + assertThrows { format.getDetails(path, "test") } + } + + @Test + fun testResources() { + val path = Paths.get("src/test/resources/azure/trace") + val reader = format.newReader(path, TABLE_RESOURCES, null) + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("x/XsOfHO4ocsV99i4NluqKDuxctW2MMVmwqOPAlg4wp8mqbBOe3wxBlQo0+Qx+uf", reader.getString(resourceID)) }, + { assertEquals(1, reader.getInt(resourceCpuCount)) }, + { assertEquals(1750000.0, reader.getDouble(resourceMemCapacity)) }, + ) + + reader.close() + } + + @Test + fun testSmoke() { + val path = Paths.get("src/test/resources/azure/trace") + val reader = format.newReader(path, TABLE_RESOURCE_STATES, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("+ZcrOp5/c/fJ6mVgP5qMZlOAGDwyjaaDNM0WoWOt2IDb47gT0UwK9lFwkPQv3C7Q", reader.getString(resourceID)) }, + { assertEquals(0, reader.getInstant(resourceStateTimestamp)?.epochSecond) }, + { assertEquals(0.0286979, reader.getDouble(resourceStateCpuUsagePct), 0.01) }, + ) + + reader.close() + } + + @DisplayName("TableReader for Resources") + @Nested + inner class ResourcesTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/azure/trace") + + columns = format.getDetails(path, TABLE_RESOURCES).columns + reader = format.newReader(path, TABLE_RESOURCES, null) + } + } + + @DisplayName("TableReader for Resource States") + @Nested + inner class ResourceStatesTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/azure/trace") + + columns = format.getDetails(path, TABLE_RESOURCE_STATES).columns + reader = format.newReader(path, TABLE_RESOURCE_STATES, null) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/bitbrains/BitbrainsExTraceFormatTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/bitbrains/BitbrainsExTraceFormatTest.kt new file mode 100644 index 00000000..0b604c18 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/bitbrains/BitbrainsExTraceFormatTest.kt @@ -0,0 +1,97 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.bitbrains + +import formats.wtf.TableReaderTestKit +import org.junit.jupiter.api.Assertions.assertAll +import org.junit.jupiter.api.Assertions.assertDoesNotThrow +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.BeforeEach +import org.junit.jupiter.api.DisplayName +import org.junit.jupiter.api.Nested +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableReader +import org.opendc.trace.bitbrains.BitbrainsExTraceFormat +import org.opendc.trace.conv.TABLE_RESOURCE_STATES +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateTimestamp +import java.nio.file.Paths + +/** + * Test suite for the [BitbrainsExTraceFormat] class. + */ +internal class BitbrainsExTraceFormatTest { + private val format = BitbrainsExTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/bitbrains/vm.txt") + + assertEquals(listOf(TABLE_RESOURCE_STATES), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/bitbrains/vm.txt") + + assertDoesNotThrow { format.getDetails(path, TABLE_RESOURCE_STATES) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/bitbrains/vm.txt") + assertThrows { format.getDetails(path, "test") } + } + + @Test + fun testSmoke() { + val path = Paths.get("src/test/resources/bitbrains/vm.txt") + val reader = format.newReader(path, TABLE_RESOURCE_STATES, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals(1631911500, reader.getInstant(resourceStateTimestamp)?.epochSecond) }, + { assertEquals(21.2, reader.getDouble(resourceStateCpuUsage), 0.01) }, + ) + + reader.close() + } + + @DisplayName("TableReader for Resource States") + @Nested + inner class ResourceStatesTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/bitbrains/vm.txt") + + columns = format.getDetails(path, TABLE_RESOURCE_STATES).columns + reader = format.newReader(path, TABLE_RESOURCE_STATES, null) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/bitbrains/BitbrainsTraceFormatTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/bitbrains/BitbrainsTraceFormatTest.kt new file mode 100644 index 00000000..d8ffb335 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/bitbrains/BitbrainsTraceFormatTest.kt @@ -0,0 +1,129 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.bitbrains + +import formats.wtf.TableReaderTestKit +import org.junit.jupiter.api.Assertions.assertAll +import org.junit.jupiter.api.Assertions.assertDoesNotThrow +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertFalse +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.BeforeEach +import org.junit.jupiter.api.DisplayName +import org.junit.jupiter.api.Nested +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableReader +import org.opendc.trace.bitbrains.BitbrainsTraceFormat +import org.opendc.trace.conv.TABLE_RESOURCES +import org.opendc.trace.conv.TABLE_RESOURCE_STATES +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateTimestamp +import java.nio.file.Paths + +/** + * Test suite for the [BitbrainsTraceFormat] class. + */ +class BitbrainsTraceFormatTest { + private val format = BitbrainsTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/bitbrains/bitbrains.csv") + + assertEquals(listOf(TABLE_RESOURCES, TABLE_RESOURCE_STATES), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/bitbrains/bitbrains.csv") + + assertDoesNotThrow { format.getDetails(path, TABLE_RESOURCE_STATES) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/bitbrains/bitbrains.csv") + assertThrows { format.getDetails(path, "test") } + } + + @Test + fun testResources() { + val path = Paths.get("src/test/resources/bitbrains/bitbrains.csv") + val reader = format.newReader(path, TABLE_RESOURCES, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("bitbrains", reader.getString(resourceID)) }, + { assertFalse(reader.nextRow()) }, + ) + + reader.close() + } + + @Test + fun testSmoke() { + val path = Paths.get("src/test/resources/bitbrains/bitbrains.csv") + val reader = format.newReader(path, TABLE_RESOURCE_STATES, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals(1376314846, reader.getInstant(resourceStateTimestamp)?.epochSecond) }, + { assertEquals(19.066, reader.getDouble(resourceStateCpuUsage), 0.01) }, + ) + + reader.close() + } + + @DisplayName("TableReader for Resources") + @Nested + inner class ResourcesTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/bitbrains/bitbrains.csv") + + columns = format.getDetails(path, TABLE_RESOURCES).columns + reader = format.newReader(path, TABLE_RESOURCES, null) + } + } + + @DisplayName("TableReader for Resource States") + @Nested + inner class ResourceStatesTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/bitbrains/bitbrains.csv") + + columns = format.getDetails(path, TABLE_RESOURCE_STATES).columns + reader = format.newReader(path, TABLE_RESOURCE_STATES, null) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/gwf/GwfTraceFormatTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/gwf/GwfTraceFormatTest.kt new file mode 100644 index 00000000..cf098556 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/gwf/GwfTraceFormatTest.kt @@ -0,0 +1,123 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.gwf + +import formats.wtf.TableReaderTestKit +import org.junit.jupiter.api.Assertions.assertAll +import org.junit.jupiter.api.Assertions.assertDoesNotThrow +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.BeforeEach +import org.junit.jupiter.api.DisplayName +import org.junit.jupiter.api.Nested +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableReader +import org.opendc.trace.conv.TABLE_TASKS +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import org.opendc.trace.gwf.GwfTraceFormat +import java.nio.file.Paths +import java.time.Duration +import java.time.Instant + +/** + * Test suite for the [GwfTraceFormat] class. + */ +@DisplayName("GWF TraceFormat") +internal class GwfTraceFormatTest { + private val format = GwfTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/gwf/trace.gwf") + + assertEquals(listOf(TABLE_TASKS), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/gwf/trace.gwf") + assertDoesNotThrow { format.getDetails(path, TABLE_TASKS) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/gwf/trace.gwf") + + assertThrows { format.getDetails(path, "test") } + } + + @Test + fun testTableReader() { + val path = Paths.get("src/test/resources/gwf/trace.gwf") + val reader = format.newReader(path, TABLE_TASKS, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("0", reader.getString(TASK_WORKFLOW_ID)) }, + { assertEquals("1", reader.getString(TASK_ID)) }, + { assertEquals(Instant.ofEpochSecond(16), reader.getInstant(TASK_SUBMIT_TIME)) }, + { assertEquals(Duration.ofSeconds(11), reader.getDuration(TASK_RUNTIME)) }, + { assertEquals(emptySet(), reader.getSet(TASK_PARENTS, String::class.java)) }, + ) + } + + @Test + fun testReadingRowWithDependencies() { + val path = Paths.get("src/test/resources/gwf/trace.gwf") + val reader = format.newReader(path, TABLE_TASKS, null) + + // Move to row 7 + for (x in 1..6) + reader.nextRow() + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("0", reader.getString(TASK_WORKFLOW_ID)) }, + { assertEquals("7", reader.getString(TASK_ID)) }, + { assertEquals(Instant.ofEpochSecond(87), reader.getInstant(TASK_SUBMIT_TIME)) }, + { assertEquals(Duration.ofSeconds(11), reader.getDuration(TASK_RUNTIME)) }, + { assertEquals(setOf("4", "5", "6"), reader.getSet(TASK_PARENTS, String::class.java)) }, + ) + } + + @DisplayName("TableReader for Tasks") + @Nested + inner class TasksTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/gwf/trace.gwf") + + columns = format.getDetails(path, TABLE_TASKS).columns + reader = format.newReader(path, TABLE_TASKS, null) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/opendc/OdcVmTraceFormatTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/opendc/OdcVmTraceFormatTest.kt new file mode 100644 index 00000000..132b1d53 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/opendc/OdcVmTraceFormatTest.kt @@ -0,0 +1,348 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.opendc + +import formats.wtf.TableReaderTestKit +import formats.wtf.TableWriterTestKit +import org.junit.jupiter.api.Assertions.assertAll +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertFalse +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.BeforeEach +import org.junit.jupiter.api.DisplayName +import org.junit.jupiter.api.Nested +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertDoesNotThrow +import org.junit.jupiter.api.assertThrows +import org.junit.jupiter.params.ParameterizedTest +import org.junit.jupiter.params.provider.ValueSource +import org.opendc.trace.TableColumn +import org.opendc.trace.TableReader +import org.opendc.trace.TableWriter +import org.opendc.trace.conv.INTERFERENCE_GROUP_MEMBERS +import org.opendc.trace.conv.INTERFERENCE_GROUP_SCORE +import org.opendc.trace.conv.INTERFERENCE_GROUP_TARGET +import org.opendc.trace.conv.TABLE_INTERFERENCE_GROUPS +import org.opendc.trace.conv.TABLE_RESOURCES +import org.opendc.trace.conv.TABLE_RESOURCE_STATES +import org.opendc.trace.conv.resourceCpuCapacity +import org.opendc.trace.conv.resourceCpuCount +import org.opendc.trace.conv.resourceID +import org.opendc.trace.conv.resourceMemCapacity +import org.opendc.trace.conv.resourceStartTime +import org.opendc.trace.conv.resourceStateCpuUsage +import org.opendc.trace.conv.resourceStateTimestamp +import org.opendc.trace.conv.resourceStopTime +import org.opendc.trace.formats.opendc.OdcVmTraceFormat +import java.nio.file.Files +import java.nio.file.Paths +import java.time.Instant + +/** + * Test suite for the [OdcVmTraceFormat] implementation. + */ +@DisplayName("OdcVmTraceFormat") +internal class OdcVmTraceFormatTest { + private val format = OdcVmTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/opendc/trace-v2.1") + + assertEquals(listOf(TABLE_RESOURCES, TABLE_RESOURCE_STATES, TABLE_INTERFERENCE_GROUPS), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/opendc/trace-v2.1") + + assertDoesNotThrow { format.getDetails(path, TABLE_RESOURCE_STATES) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/opendc/trace-v2.1") + assertThrows { format.getDetails(path, "test") } + } + + @ParameterizedTest + @ValueSource(strings = ["trace-v2.0", "trace-v2.1"]) + fun testResources(name: String) { + val path = Paths.get("src/test/resources/opendc/$name") + val reader = format.newReader(path, TABLE_RESOURCES, listOf(resourceID, resourceStartTime)) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("1019", reader.getString(resourceID)) }, + { assertEquals(Instant.ofEpochMilli(1376314846000), reader.getInstant(resourceStartTime)) }, + { assertTrue(reader.nextRow()) }, + { assertEquals("1023", reader.getString(resourceID)) }, + { assertTrue(reader.nextRow()) }, + { assertEquals("1052", reader.getString(resourceID)) }, + { assertTrue(reader.nextRow()) }, + { assertEquals("1073", reader.getString(resourceID)) }, + { assertFalse(reader.nextRow()) }, + ) + + reader.close() + } + + @Test + fun testResourcesWrite() { + val path = Files.createTempDirectory("opendc") + val writer = format.newWriter(path, TABLE_RESOURCES) + + writer.startRow() + writer.setString(resourceID, "1019") + writer.setInstant(resourceStartTime, Instant.EPOCH) + writer.setInstant(resourceStopTime, Instant.EPOCH) + writer.setInt(resourceCpuCount, 1) + writer.setDouble(resourceCpuCapacity, 1024.0) + writer.setDouble(resourceMemCapacity, 1024.0) + writer.endRow() + writer.close() + + val reader = format.newReader(path, TABLE_RESOURCES, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("1019", reader.getString(resourceID)) }, + { assertEquals(Instant.EPOCH, reader.getInstant(resourceStartTime)) }, + { assertEquals(Instant.EPOCH, reader.getInstant(resourceStopTime)) }, + { assertEquals(1, reader.getInt(resourceCpuCount)) }, + { assertEquals(1024.0, reader.getDouble(resourceCpuCapacity)) }, + { assertEquals(1024.0, reader.getDouble(resourceMemCapacity)) }, + { assertFalse(reader.nextRow()) }, + ) + + reader.close() + } + + @ParameterizedTest + @ValueSource(strings = ["trace-v2.0", "trace-v2.1"]) + fun testSmoke(name: String) { + val path = Paths.get("src/test/resources/opendc/$name") + val reader = + format.newReader( + path, + TABLE_RESOURCE_STATES, + listOf(resourceID, resourceStateTimestamp, resourceStateCpuUsage), + ) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("1019", reader.getString(resourceID)) }, + { assertEquals(1376314846, reader.getInstant(resourceStateTimestamp)?.epochSecond) }, + { assertEquals(0.0, reader.getDouble(resourceStateCpuUsage), 0.01) }, + ) + + reader.close() + } + + @Test + fun testResourceStatesWrite() { + val path = Files.createTempDirectory("opendc") + val writer = format.newWriter(path, TABLE_RESOURCE_STATES) + + writer.startRow() + writer.setString(resourceID, "1019") + writer.setInstant(resourceStateTimestamp, Instant.EPOCH) + writer.setDouble(resourceStateCpuUsage, 23.0) + writer.setInt(resourceCpuCount, 1) + writer.endRow() + writer.close() + + val reader = format.newReader(path, TABLE_RESOURCE_STATES, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("1019", reader.getString(resourceID)) }, + { assertEquals(Instant.EPOCH, reader.getInstant(resourceStateTimestamp)) }, + { assertEquals(1, reader.getInt(resourceCpuCount)) }, + { assertEquals(23.0, reader.getDouble(resourceStateCpuUsage)) }, + { assertFalse(reader.nextRow()) }, + ) + + reader.close() + } + + @Test + fun testInterferenceGroups() { + val path = Paths.get("src/test/resources/opendc/trace-v2.1") + val reader = + format.newReader( + path, + TABLE_INTERFERENCE_GROUPS, + listOf(INTERFERENCE_GROUP_MEMBERS, INTERFERENCE_GROUP_TARGET, INTERFERENCE_GROUP_SCORE), + ) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals(setOf("1019", "1023", "1052"), reader.getSet(INTERFERENCE_GROUP_MEMBERS, String::class.java)) }, + { assertEquals(0.0, reader.getDouble(INTERFERENCE_GROUP_TARGET)) }, + { assertEquals(0.8830158730158756, reader.getDouble(INTERFERENCE_GROUP_SCORE)) }, + { assertTrue(reader.nextRow()) }, + { assertEquals(setOf("1023", "1052", "1073"), reader.getSet(INTERFERENCE_GROUP_MEMBERS, String::class.java)) }, + { assertEquals(0.0, reader.getDouble(INTERFERENCE_GROUP_TARGET)) }, + { assertEquals(0.7133055555552751, reader.getDouble(INTERFERENCE_GROUP_SCORE)) }, + { assertFalse(reader.nextRow()) }, + ) + + reader.close() + } + + @Test + fun testInterferenceGroupsEmpty() { + val path = Paths.get("src/test/resources/opendc/trace-v2.0") + val reader = format.newReader(path, TABLE_INTERFERENCE_GROUPS, listOf(INTERFERENCE_GROUP_MEMBERS)) + + assertFalse(reader.nextRow()) + reader.close() + } + + @Test + fun testInterferenceGroupsWrite() { + val path = Files.createTempDirectory("opendc") + val writer = format.newWriter(path, TABLE_INTERFERENCE_GROUPS) + + writer.startRow() + writer.setSet(INTERFERENCE_GROUP_MEMBERS, setOf("a", "b", "c")) + writer.setDouble(INTERFERENCE_GROUP_TARGET, 0.5) + writer.setDouble(INTERFERENCE_GROUP_SCORE, 0.8) + writer.endRow() + writer.flush() + + writer.startRow() + writer.setSet(INTERFERENCE_GROUP_MEMBERS, setOf("a", "b", "d")) + writer.setDouble(INTERFERENCE_GROUP_TARGET, 0.5) + writer.setDouble(INTERFERENCE_GROUP_SCORE, 0.9) + writer.endRow() + writer.close() + + val reader = format.newReader(path, TABLE_INTERFERENCE_GROUPS, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals(setOf("a", "b", "c"), reader.getSet(INTERFERENCE_GROUP_MEMBERS, String::class.java)) }, + { assertEquals(0.5, reader.getDouble(INTERFERENCE_GROUP_TARGET)) }, + { assertEquals(0.8, reader.getDouble(INTERFERENCE_GROUP_SCORE)) }, + { assertTrue(reader.nextRow()) }, + { assertEquals(setOf("a", "b", "d"), reader.getSet(INTERFERENCE_GROUP_MEMBERS, String::class.java)) }, + { assertEquals(0.5, reader.getDouble(INTERFERENCE_GROUP_TARGET)) }, + { assertEquals(0.9, reader.getDouble(INTERFERENCE_GROUP_SCORE)) }, + { assertFalse(reader.nextRow()) }, + ) + + reader.close() + } + + @DisplayName("TableReader for Resources") + @Nested + inner class ResourcesTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/opendc/trace-v2.1") + + columns = format.getDetails(path, TABLE_RESOURCES).columns + reader = format.newReader(path, TABLE_RESOURCES, null) + } + } + + @DisplayName("TableWriter for Resources") + @Nested + inner class ResourcesTableWriterTest : TableWriterTestKit() { + override lateinit var writer: TableWriter + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Files.createTempDirectory("opendc") + + columns = format.getDetails(Paths.get("src/test/resources/opendc/trace-v2.1"), TABLE_RESOURCES).columns + writer = format.newWriter(path, TABLE_RESOURCES) + } + } + + @DisplayName("TableReader for Resource States") + @Nested + inner class ResourceStatesTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/opendc/trace-v2.1") + + columns = format.getDetails(path, TABLE_RESOURCE_STATES).columns + reader = format.newReader(path, TABLE_RESOURCE_STATES, null) + } + } + + @DisplayName("TableWriter for Resource States") + @Nested + inner class ResourceStatesTableWriterTest : TableWriterTestKit() { + override lateinit var writer: TableWriter + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Files.createTempDirectory("opendc") + + columns = format.getDetails(Paths.get("src/test/resources/opendc/trace-v2.1"), TABLE_RESOURCE_STATES).columns + writer = format.newWriter(path, TABLE_RESOURCE_STATES) + } + } + + @DisplayName("TableReader for Interference Groups") + @Nested + inner class InterferenceGroupsTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/opendc/trace-v2.1") + + columns = format.getDetails(path, TABLE_INTERFERENCE_GROUPS).columns + reader = format.newReader(path, TABLE_INTERFERENCE_GROUPS, null) + } + } + + @DisplayName("TableWriter for Interference Groups") + @Nested + inner class InterferenceGroupsTableWriterTest : TableWriterTestKit() { + override lateinit var writer: TableWriter + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Files.createTempDirectory("opendc") + + columns = format.getDetails(Paths.get("src/test/resources/opendc/trace-v2.1"), TABLE_INTERFERENCE_GROUPS).columns + writer = format.newWriter(path, TABLE_INTERFERENCE_GROUPS) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/swf/SwfTraceFormatTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/swf/SwfTraceFormatTest.kt new file mode 100644 index 00000000..c4c4e24a --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/swf/SwfTraceFormatTest.kt @@ -0,0 +1,101 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.swf + +import formats.wtf.TableReaderTestKit +import org.junit.jupiter.api.Assertions.assertAll +import org.junit.jupiter.api.Assertions.assertDoesNotThrow +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.BeforeEach +import org.junit.jupiter.api.DisplayName +import org.junit.jupiter.api.Nested +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableReader +import org.opendc.trace.conv.TABLE_TASKS +import org.opendc.trace.conv.TASK_ALLOC_NCPUS +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.swf.SwfTraceFormat +import java.nio.file.Paths + +/** + * Test suite for the [SwfTraceFormat] class. + */ +@DisplayName("SWF TraceFormat") +internal class SwfTraceFormatTest { + private val format = SwfTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/swf/trace.swf") + + assertEquals(listOf(TABLE_TASKS), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/swf/trace.swf") + assertDoesNotThrow { format.getDetails(path, TABLE_TASKS) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/swf/trace.swf") + + assertThrows { format.getDetails(path, "test") } + } + + @Test + fun testReader() { + val path = Paths.get("src/test/resources/swf/trace.swf") + val reader = format.newReader(path, TABLE_TASKS, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("1", reader.getString(TASK_ID)) }, + { assertEquals(306, reader.getInt(TASK_ALLOC_NCPUS)) }, + { assertTrue(reader.nextRow()) }, + { assertEquals("2", reader.getString(TASK_ID)) }, + { assertEquals(17, reader.getInt(TASK_ALLOC_NCPUS)) }, + ) + + reader.close() + } + + @DisplayName("TableReader for Tasks") + @Nested + inner class TasksTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/swf/trace.swf") + + columns = format.getDetails(path, TABLE_TASKS).columns + reader = format.newReader(path, TABLE_TASKS, null) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wfformat/WfFormatTaskTableReaderTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wfformat/WfFormatTaskTableReaderTest.kt new file mode 100644 index 00000000..1701e566 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wfformat/WfFormatTaskTableReaderTest.kt @@ -0,0 +1,361 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.wfformat + +import com.fasterxml.jackson.core.JsonFactory +import com.fasterxml.jackson.core.JsonParseException +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertFalse +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertDoesNotThrow +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.wfformat.WfFormatTaskTableReader + +/** + * Test suite for the [WfFormatTaskTableReader] class. + */ +internal class WfFormatTaskTableReaderTest { + /** + * The [JsonFactory] used to construct the parser. + */ + private val factory = JsonFactory() + + @Test + fun testEmptyInput() { + val content = "" + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertFalse(reader.nextRow()) + reader.close() + } + + @Test + fun testTopLevelArrayInput() { + val content = "[]" + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testNoWorkflow() { + val content = + """ + { + "name": "eager-nextflow-chameleon" + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testWorkflowArrayType() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": [] + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testWorkflowNullType() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": null + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows { + while (reader.nextRow()) { + continue + } + } + + reader.close() + } + + @Test + fun testNoJobs() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsObjectType() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { "jobs": {} } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsNullType() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { "jobs": null } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsInvalidChildType() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [1] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsValidChildType() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test" + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertEquals("test", reader.getString(TASK_ID)) + assertFalse(reader.nextRow()) + + reader.close() + } + + @Test + fun testJobsInvalidParents() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": 1, + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsInvalidParentsItem() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": [1], + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertThrows { reader.nextRow() } + + reader.close() + } + + @Test + fun testJobsValidParents() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertEquals(setOf("1"), reader.getSet(TASK_PARENTS, String::class.java)) + assertFalse(reader.nextRow()) + + reader.close() + } + + @Test + fun testJobsInvalidSecondEntry() { + val content = + """ + { + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + }, + "test" + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertDoesNotThrow { reader.nextRow() } + assertThrows { reader.nextRow() } + + reader.close() + } + + @Test + fun testDuplicateJobsArray() { + val content = + """ + { + "name": "eager-nextflow-chameleon", + "workflow": { + "jobs": [ + { + "name": "test", + "parents": ["1"] + } + ], + "jobs": [ + { + "name": "test2", + "parents": ["test"] + } + ] + } + } + """.trimIndent() + val parser = factory.createParser(content) + val reader = WfFormatTaskTableReader(parser) + + assertTrue(reader.nextRow()) + assertTrue(reader.nextRow()) + assertEquals("test2", reader.getString(TASK_ID)) + assertFalse(reader.nextRow()) + + reader.close() + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wfformat/WfFormatTraceFormatTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wfformat/WfFormatTraceFormatTest.kt new file mode 100644 index 00000000..94ed30d7 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wfformat/WfFormatTraceFormatTest.kt @@ -0,0 +1,129 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.wfformat + +import org.junit.jupiter.api.Assertions.assertAll +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.BeforeEach +import org.junit.jupiter.api.DisplayName +import org.junit.jupiter.api.Nested +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertDoesNotThrow +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableReader +import org.opendc.trace.conv.TABLE_TASKS +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import org.opendc.trace.testkit.TableReaderTestKit +import org.opendc.trace.wfformat.WfFormatTraceFormat +import java.nio.file.Paths + +/** + * Test suite for the [WfFormatTraceFormat] class. + */ +@DisplayName("WfFormat TraceFormat") +class WfFormatTraceFormatTest { + private val format = WfFormatTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/wfformat/trace.json") + + assertEquals(listOf(TABLE_TASKS), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/wfformat/trace.json") + assertDoesNotThrow { format.getDetails(path, TABLE_TASKS) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/wfformat/trace.json") + + assertThrows { format.getDetails(path, "test") } + } + + /** + * Smoke test for parsing WfCommons traces. + */ + @Test + fun testTableReader() { + val path = Paths.get("src/test/resources/wfformat/trace.json") + val reader = format.newReader(path, TABLE_TASKS, null) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("makebwaindex_mammoth_mt_krause.fasta", reader.getString(TASK_ID)) }, + { assertEquals("eager-nextflow-chameleon", reader.getString(TASK_WORKFLOW_ID)) }, + { assertEquals(172000, reader.getDuration(TASK_RUNTIME)?.toMillis()) }, + { assertEquals(emptySet(), reader.getSet(TASK_PARENTS, String::class.java)) }, + ) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("makeseqdict_mammoth_mt_krause.fasta", reader.getString(TASK_ID)) }, + { assertEquals("eager-nextflow-chameleon", reader.getString(TASK_WORKFLOW_ID)) }, + { assertEquals(175000, reader.getDuration(TASK_RUNTIME)?.toMillis()) }, + { assertEquals(setOf("makebwaindex_mammoth_mt_krause.fasta"), reader.getSet(TASK_PARENTS, String::class.java)) }, + ) + + reader.close() + } + + /** + * Test full iteration of the table. + */ + @Test + fun testTableReaderFull() { + val path = Paths.get("src/test/resources/wfformat/trace.json") + val reader = format.newReader(path, TABLE_TASKS, null) + + assertDoesNotThrow { + while (reader.nextRow()) { + // reader.get(TASK_ID) + } + reader.close() + } + } + + @DisplayName("TableReader for Tasks") + @Nested + inner class TasksTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/wfformat/trace.json") + + columns = format.getDetails(path, TABLE_TASKS).columns + reader = format.newReader(path, TABLE_TASKS, null) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/TableReaderTestKit.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/TableReaderTestKit.kt new file mode 100644 index 00000000..cb6db43f --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/TableReaderTestKit.kt @@ -0,0 +1,190 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.wtf + +import org.junit.jupiter.api.AfterEach +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertFalse +import org.junit.jupiter.api.Assertions.assertNotEquals +import org.junit.jupiter.api.Assumptions.assumeTrue +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertAll +import org.junit.jupiter.api.assertDoesNotThrow +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableReader + +/** + * A test suite for implementations of the [TableReader] interface. + */ +public abstract class TableReaderTestKit { + /** + * The [TableReader] instance to test. + */ + public abstract val reader: TableReader + + /** + * The columns of the table. + */ + public abstract val columns: List + + @AfterEach + public fun tearDown() { + reader.close() + } + + /** + * Test that we can resolve the columns of a table successfully. + */ + @Test + public fun testResolve() { + assertAll(columns.map { column -> { assertNotEquals(-1, reader.resolve(column.name)) } }) + } + + /** + * Test that resolving an empty column name fails + */ + @Test + public fun testResolveEmpty() { + assertEquals(-1, reader.resolve("")) + } + + /** + * Test that reading non-existent columns fails. + */ + @Test + public fun testReadNonExistentColumns() { + assumeTrue(reader.nextRow()) + assertAll( + { assertThrows { reader.isNull(-1) } }, + { assertThrows { reader.getBoolean(-1) } }, + { assertThrows { reader.getInt(-1) } }, + { assertThrows { reader.getLong(-1) } }, + { assertThrows { reader.getFloat(-1) } }, + { assertThrows { reader.getDouble(-1) } }, + { assertThrows { reader.getString(-1) } }, + { assertThrows { reader.getUUID(-1) } }, + { assertThrows { reader.getInstant(-1) } }, + { assertThrows { reader.getDuration(-1) } }, + { assertThrows { reader.getList(-1, Any::class.java) } }, + { assertThrows { reader.getSet(-1, Any::class.java) } }, + { assertThrows { reader.getMap(-1, Any::class.java, Any::class.java) } }, + ) + } + + /** + * Test that ensures [TableReader.isNull] reports the correct value. + */ + @Test + public fun testVerifyNullColumns() { + while (reader.nextRow()) { + assertAll( + columns.map { column -> + { + when (column.type) { + is TableColumnType.Boolean -> assertFalse(reader.isNull(column.name) && !reader.getBoolean(column.name)) + is TableColumnType.Int -> assertFalse(reader.isNull(column.name) && reader.getInt(column.name) != 0) + is TableColumnType.Long -> assertFalse(reader.isNull(column.name) && reader.getLong(column.name) != 0L) + is TableColumnType.Float -> assertFalse(reader.isNull(column.name) && reader.getFloat(column.name) != 0f) + is TableColumnType.Double -> assertFalse(reader.isNull(column.name) && reader.getDouble(column.name) != 0.0) + is TableColumnType.String -> assertFalse(reader.isNull(column.name) && reader.getString(column.name) != null) + is TableColumnType.UUID -> assertFalse(reader.isNull(column.name) && reader.getUUID(column.name) != null) + is TableColumnType.Instant -> assertFalse(reader.isNull(column.name) && reader.getInstant(column.name) != null) + is TableColumnType.Duration -> + assertFalse( + reader.isNull(column.name) && reader.getDuration(column.name) != null, + ) + is TableColumnType.List -> + assertFalse( + reader.isNull(column.name) && reader.getList(column.name, Any::class.java) != null, + ) + is TableColumnType.Set -> + assertFalse( + reader.isNull(column.name) && reader.getSet(column.name, Any::class.java) != null, + ) + is TableColumnType.Map -> + assertFalse( + reader.isNull(column.name) && reader.getMap(column.name, Any::class.java, Any::class.java) != null, + ) + } + } + }, + ) + } + } + + /** + * Test that we can read the entire table without any issue. + */ + @Test + public fun testReadFully() { + assertDoesNotThrow { + while (reader.nextRow()) { + assertAll(columns.map { column -> { assertDoesNotThrow { reader.get(column) } } }) + } + reader.close() + } + + assertFalse(reader.nextRow()) { "Reader does not reset" } + } + + /** + * Test that the reader throws an exception when the columns are read without a call to [TableReader.nextRow] + */ + @Test + public fun testReadWithoutNextRow() { + assertAll(columns.map { column -> { assertThrows { reader.get(column) } } }) + } + + /** + * Test that the reader throws an exception when the columns are read after the [TableReader] is finished. + */ + @Test + public fun testReadAfterFinish() { + @Suppress("ControlFlowWithEmptyBody") + while (reader.nextRow()) {} + + testReadWithoutNextRow() + } + + /** + * Helper method to map a [TableColumn] to a read. + */ + private fun TableReader.get(column: TableColumn): Any? { + return when (column.type) { + is TableColumnType.Boolean -> getBoolean(column.name) + is TableColumnType.Int -> getInt(column.name) + is TableColumnType.Long -> getLong(column.name) + is TableColumnType.Float -> getFloat(column.name) + is TableColumnType.Double -> getDouble(column.name) + is TableColumnType.String -> getString(column.name) + is TableColumnType.UUID -> getUUID(column.name) + is TableColumnType.Instant -> getInstant(column.name) + is TableColumnType.Duration -> getDuration(column.name) + is TableColumnType.List -> getList(column.name, Any::class.java) + is TableColumnType.Set -> getSet(column.name, Any::class.java) + is TableColumnType.Map -> getMap(column.name, Any::class.java, Any::class.java) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/TableWriterTestKit.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/TableWriterTestKit.kt new file mode 100644 index 00000000..1c819fff --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/TableWriterTestKit.kt @@ -0,0 +1,131 @@ +/* + * Copyright (c) 2022 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package formats.wtf + +import org.junit.jupiter.api.AfterEach +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertNotEquals +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertAll +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableColumnType +import org.opendc.trace.TableWriter +import java.time.Duration +import java.time.Instant +import java.util.UUID + +/** + * A test suite for implementations of the [TableWriter] interface. + */ +public abstract class TableWriterTestKit { + /** + * The [TableWriter] instance to test. + */ + public abstract val writer: TableWriter + + /** + * The columns of the table. + */ + public abstract val columns: List + + @AfterEach + public fun tearDown() { + writer.close() + } + + /** + * Test that we can resolve the columns of a table successfully. + */ + @Test + public fun testResolve() { + assertAll(columns.map { column -> { assertNotEquals(-1, writer.resolve(column.name)) } }) + } + + /** + * Test that resolving an empty column name fails + */ + @Test + public fun testResolveEmpty() { + assertEquals(-1, writer.resolve("")) + } + + /** + * Test that writing non-existent columns fails. + */ + @Test + public fun testWriteNonExistentColumns() { + writer.startRow() + assertAll( + { assertThrows { writer.setBoolean(-1, false) } }, + { assertThrows { writer.setInt(-1, 1) } }, + { assertThrows { writer.setLong(-1, 1) } }, + { assertThrows { writer.setFloat(-1, 1f) } }, + { assertThrows { writer.setDouble(-1, 1.0) } }, + { assertThrows { writer.setString(-1, "test") } }, + { assertThrows { writer.setUUID(-1, UUID.randomUUID()) } }, + { assertThrows { writer.setInstant(-1, Instant.now()) } }, + { assertThrows { writer.setDuration(-1, Duration.ofMinutes(5)) } }, + { assertThrows { writer.setList(-1, listOf("test")) } }, + { assertThrows { writer.setSet(-1, setOf("test")) } }, + { assertThrows { writer.setMap(-1, mapOf("test" to "test")) } }, + ) + } + + /** + * Test that writing columns without a row fails. + */ + @Test + public fun testWriteWithoutRow() { + assertAll( + columns.map { column -> + { + assertThrows { + when (column.type) { + is TableColumnType.Boolean -> writer.setBoolean(column.name, true) + is TableColumnType.Int -> writer.setInt(column.name, 21) + is TableColumnType.Long -> writer.setLong(column.name, 21) + is TableColumnType.Float -> writer.setFloat(column.name, 42f) + is TableColumnType.Double -> writer.setDouble(column.name, 42.0) + is TableColumnType.String -> writer.setString(column.name, "test") + is TableColumnType.UUID -> writer.setUUID(column.name, UUID.randomUUID()) + is TableColumnType.Instant -> writer.setInstant(column.name, Instant.now()) + is TableColumnType.Duration -> writer.setDuration(column.name, Duration.ofMinutes(5)) + is TableColumnType.List -> writer.setList(column.name, emptyList()) + is TableColumnType.Set -> writer.setSet(column.name, emptySet()) + is TableColumnType.Map -> writer.setMap(column.name, emptyMap()) + } + } + } + }, + ) + } + + /** + * Test to verify we cannot end a row without starting it. + */ + @Test + public fun testEndRowWithoutStart() { + assertThrows { writer.endRow() } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/WtfTraceFormatTest.kt b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/WtfTraceFormatTest.kt new file mode 100644 index 00000000..d218fbf3 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/kotlin/formats/wtf/WtfTraceFormatTest.kt @@ -0,0 +1,141 @@ +/* + * Copyright (c) 2021 AtLarge Research + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +package org.opendc.trace.wtf + +import formats.wtf.TableReaderTestKit +import org.junit.jupiter.api.Assertions.assertAll +import org.junit.jupiter.api.Assertions.assertDoesNotThrow +import org.junit.jupiter.api.Assertions.assertEquals +import org.junit.jupiter.api.Assertions.assertTrue +import org.junit.jupiter.api.BeforeEach +import org.junit.jupiter.api.DisplayName +import org.junit.jupiter.api.Nested +import org.junit.jupiter.api.Test +import org.junit.jupiter.api.assertThrows +import org.opendc.trace.TableColumn +import org.opendc.trace.TableReader +import org.opendc.trace.conv.TABLE_TASKS +import org.opendc.trace.conv.TASK_ID +import org.opendc.trace.conv.TASK_PARENTS +import org.opendc.trace.conv.TASK_RUNTIME +import org.opendc.trace.conv.TASK_SUBMIT_TIME +import org.opendc.trace.conv.TASK_WORKFLOW_ID +import java.nio.file.Paths +import java.time.Duration +import java.time.Instant + +/** + * Test suite for the [WtfTraceFormat] class. + */ +@DisplayName("WTF TraceFormat") +class WtfTraceFormatTest { + private val format = WtfTraceFormat() + + @Test + fun testTables() { + val path = Paths.get("src/test/resources/wtf/schema-1.0") + assertEquals(listOf(TABLE_TASKS), format.getTables(path)) + } + + @Test + fun testTableExists() { + val path = Paths.get("src/test/resources/wtf/wtf-trace") + assertDoesNotThrow { format.getDetails(path, TABLE_TASKS) } + } + + @Test + fun testTableDoesNotExist() { + val path = Paths.get("src/test/resources/wtf/wtf-trace") + + assertThrows { format.getDetails(path, "test") } + } + + /** + * Smoke test for parsing WTF traces. + */ + @Test + fun testTableReader() { + val path = Paths.get("src/test/resources/wtf/wtf-trace") + val reader = format.newReader(path, TABLE_TASKS, listOf(TASK_ID, TASK_WORKFLOW_ID, TASK_SUBMIT_TIME, TASK_RUNTIME, TASK_PARENTS)) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("362334516345962206", reader.getString(TASK_ID)) }, + { assertEquals("1078341553348591493", reader.getString(TASK_WORKFLOW_ID)) }, + { assertEquals(Instant.ofEpochMilli(245604), reader.getInstant(TASK_SUBMIT_TIME)) }, + { assertEquals(Duration.ofMillis(8163), reader.getDuration(TASK_RUNTIME)) }, + { + assertEquals( + setOf("584055316413447529", "133113685133695608", "1008582348422865408"), + reader.getSet(TASK_PARENTS, String::class.java), + ) + }, + ) + + assertAll( + { assertTrue(reader.nextRow()) }, + { assertEquals("502010169100446658", reader.getString(TASK_ID)) }, + { assertEquals("1078341553348591493", reader.getString(TASK_WORKFLOW_ID)) }, + { assertEquals(Instant.ofEpochMilli(251325), reader.getInstant(TASK_SUBMIT_TIME)) }, + { assertEquals(Duration.ofMillis(8216), reader.getDuration(TASK_RUNTIME)) }, + { + assertEquals( + setOf("584055316413447529", "133113685133695608", "1008582348422865408"), + reader.getSet(TASK_PARENTS, String::class.java), + ) + }, + ) + + reader.close() + } + + @DisplayName("TableReader for Tasks") + @Nested + inner class TasksTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/wtf/wtf-trace") + + columns = format.getDetails(path, TABLE_TASKS).columns + reader = format.newReader(path, TABLE_TASKS, null) + } + } + + @DisplayName("TableReader for Tasks (Shell trace)") + @Nested + inner class ShellTasksTableReaderTest : TableReaderTestKit() { + override lateinit var reader: TableReader + override lateinit var columns: List + + @BeforeEach + fun setUp() { + val path = Paths.get("src/test/resources/wtf/shell") + + columns = format.getDetails(path, TABLE_TASKS).columns + reader = format.newReader(path, TABLE_TASKS, null) + } + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/resources/azure/trace/vm_cpu_readings/vm_cpu_readings-file-1-of-125.csv.gz b/opendc-trace/opendc-trace-api/src/test/resources/azure/trace/vm_cpu_readings/vm_cpu_readings-file-1-of-125.csv.gz new file mode 100644 index 00000000..592c7316 Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/azure/trace/vm_cpu_readings/vm_cpu_readings-file-1-of-125.csv.gz differ diff --git a/opendc-trace/opendc-trace-api/src/test/resources/azure/trace/vmtable/vmtable.csv.gz b/opendc-trace/opendc-trace-api/src/test/resources/azure/trace/vmtable/vmtable.csv.gz new file mode 100644 index 00000000..0adc6b7e Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/azure/trace/vmtable/vmtable.csv.gz differ diff --git a/opendc-trace/opendc-trace-api/src/test/resources/bitbrains/bitbrains.csv b/opendc-trace/opendc-trace-api/src/test/resources/bitbrains/bitbrains.csv new file mode 100644 index 00000000..f5e300e8 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/resources/bitbrains/bitbrains.csv @@ -0,0 +1,8620 @@ +Timestamp [ms]; CPU cores; CPU capacity provisioned [MHZ]; CPU usage [MHZ]; CPU usage [%]; Memory capacity provisioned [KB]; Memory usage [KB]; Disk read throughput [KB/s]; Disk write throughput [KB/s]; Network received throughput [KB/s]; Network transmitted throughput [KB/s] +1376314846; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.4666666666666666; 0.0; 0.0 +1376315146; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376315446; 1; 2599.999309; 17.333328726666668; 0.6666666666666667; 2097152.0; 103457.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376315746; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 76893.33333333333; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376316046; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376316346; 1; 2599.999309; 17.333328726666668; 0.6666666666666667; 2097152.0; 90874.66666666667; 0.0; 1.2; 0.0; 0.0 +1376316646; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 128624.26666666666; 0.06666666666666667; 8.733333333333333; 0.3333333333333333; 0.6 +1376316946; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 134216.8; 0.0; 1.2; 0.0; 0.0 +1376317246; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1376317546; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 1.5333333333333334; 0.0; 0.0 +1376317846; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 81087.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1376318146; 1; 2599.999309; 17.333328726666668; 0.6666666666666667; 2097152.0; 95069.06666666667; 0.06666666666666667; 1.6; 0.06666666666666667; 0.13333333333333333 +1376318446; 1; 2599.999309; 20.799994471999998; 0.8; 2097152.0; 82485.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376318746; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1376319046; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.2; 0.0; 0.0 +1376319346; 1; 2599.999626; 38.99999439; 1.5; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1376319646; 1; 2599.999626; 13.866664671999999; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1376319946; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1376320246; 1; 2599.999626; 41.599994016000004; 1.6; 2097152.0; 150993.6; 0.0; 2.7333333333333334; 67.46666666666667; 0.5333333333333333 +1376320546; 1; 2599.999626; 10.399998504000001; 0.4; 2097152.0; 141207.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376320846; 1; 2599.999626; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376321146; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 71300.8; 0.0; 1.0; 0.06666666666666667; 0.0 +1376321446; 1; 2599.999626; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1376321746; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 121633.6; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376322046; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376322346; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 121633.6; 0.0; 1.4666666666666666; 0.6; 0.0 +1376322647; 1; 2599.999626; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376322947; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 75495.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1376323247; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 117439.2; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1376323547; 1; 2599.999626; 12.133331587999999; 0.4666666666666666; 2097152.0; 130022.4; 0.0; 1.2; 0.0; 0.0 +1376323847; 1; 2599.999626; 13.866664671999999; 0.5333333333333333; 2097152.0; 146800.0; 0.0; 2.466666666666667; 0.0; 0.5333333333333333 +1376324147; 1; 2599.999626; 12.133331587999999; 0.4666666666666666; 2097152.0; 110448.53333333334; 0.2; 1.5333333333333334; 0.0; 0.0 +1376324447; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.5333333333333334; 0.0; 0.0 +1376324747; 1; 2599.999626; 0.0; 0.0; 2097152.0; 62912.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376325047; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 82485.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376325347; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1376325647; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 125827.2; 0.0; 1.2; 0.0; 0.0 +1376325947; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376326247; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1376326547; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 86680.26666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1376326847; 1; 2599.999626; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1376327147; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1376327447; 1; 2599.999626; 13.866664671999999; 0.5333333333333333; 2097152.0; 198527.73333333334; 0.0; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1376327747; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 130021.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376328047; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376328347; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376328647; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 1.4; 0.0; 0.0 +1376328947; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 96467.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1376329247; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.2; 0.0; 0.0 +1376329547; 1; 2599.999626; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.2; 0.0; 0.0 +1376329847; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 85282.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376330147; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 125828.0; 0.2; 7.466666666666667; 0.2; 0.13333333333333333 +1376330447; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1376330747; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 155188.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376331047; 1; 2599.999626; 12.133331587999999; 0.4666666666666666; 2097152.0; 167771.2; 0.0; 2.466666666666667; 0.3333333333333333; 0.4666666666666667 +1376331347; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 132817.6; 0.0; 1.6666666666666667; 0.0; 0.0 +1376331647; 1; 2599.999626; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1376331947; 1; 2599.999626; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376332247; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376332547; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376332847; 1; 2599.999626; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.6; 0.0; 0.0 +1376333147; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1376333447; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1376333747; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376334047; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 82485.86666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1376334347; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 97865.33333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1376334647; 1; 2599.999626; 17.333330840000002; 0.6666666666666667; 2097152.0; 170565.86666666667; 0.0; 2.2666666666666666; 0.13333333333333333; 0.4666666666666667 +1376334947; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 128624.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376335247; 1; 2599.999626; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.2; 0.0; 0.0 +1376335547; 1; 2599.999626; 46.799993268; 1.8; 2097152.0; 341134.4; 161.73333333333332; 14.666666666666666; 0.0; 0.2 +1376335847; 1; 2599.999626; 13.866664671999999; 0.5333333333333333; 2097152.0; 216702.93333333332; 0.0; 7.733333333333333; 0.26666666666666666; 0.13333333333333333 +1376336147; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 160780.53333333333; 31.8; 3.8666666666666667; 0.0; 0.0 +1376336447; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 135614.13333333333; 0.0; 1.3333333333333333; 0.26666666666666666; 0.0 +1376336747; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 106254.13333333333; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376337047; 1; 2599.999626; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.2; 0.0; 0.0 +1376337347; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 111846.66666666667; 0.0; 1.0; 0.0; 0.0 +1376337647; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376337947; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 135614.93333333332; 0.0; 1.0; 0.0; 0.0 +1376338248; 1; 2599.999626; 12.133331587999999; 0.4666666666666666; 2097152.0; 205518.66666666666; 0.0; 3.066666666666667; 0.0; 0.4666666666666667 +1376338548; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 138410.93333333332; 0.06666666666666667; 1.5333333333333334; 0.0; 0.0 +1376338848; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376339148; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376339448; 1; 2599.999626; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376339748; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376340048; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 1.2; 0.0; 0.0 +1376340348; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.6666666666666666; 0.0 +1376340648; 1; 2599.999626; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376340948; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1376341248; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 123030.93333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376341548; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 1.2; 0.0; 0.0 +1376341848; 1; 2599.999626; 17.333330840000002; 0.6666666666666667; 2097152.0; 127225.33333333333; 0.2; 2.6666666666666665; 0.0; 0.4666666666666667 +1376342148; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 1.2; 0.06666666666666667; 0.0 +1376342448; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 1.4; 0.0; 0.0 +1376342748; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 111846.66666666667; 0.06666666666666667; 7.2; 0.26666666666666666; 0.13333333333333333 +1376343048; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1376343348; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.3333333333333333; 0.13333333333333333; 0.0 +1376343648; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.3333333333333333; 0.3333333333333333; 0.0 +1376343948; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 149594.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1376344248; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 150993.6; 0.0; 1.1333333333333333; 0.6; 0.0 +1376344548; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 100661.6; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376344848; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376345148; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 1.5333333333333334; 0.0; 0.0 +1376345448; 1; 2599.999626; 12.133331587999999; 0.4666666666666666; 2097152.0; 162177.86666666667; 0.0; 2.8; 0.06666666666666667; 0.4666666666666667 +1376345748; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 131420.26666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1376346048; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 1.2; 0.0; 0.0 +1376346348; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 90874.66666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376346648; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 74097.06666666667; 2.6666666666666665; 1.4666666666666666; 0.13333333333333333; 0.0 +1376346948; 1; 2599.999626; 10.399998504000001; 0.4; 2097152.0; 118837.33333333333; 0.0; 1.4666666666666666; 0.06666666666666667; 0.13333333333333333 +1376347248; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 1.4; 0.0; 0.0 +1376347548; 1; 2599.999626; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376347848; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1376348148; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 106254.13333333333; 0.0; 7.466666666666667; 0.26666666666666666; 0.2 +1376348448; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.0; 0.0 +1376348749; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1376349049; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 137012.26666666666; 0.0; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1376349349; 1; 2599.999626; 41.599994016000004; 1.6; 2097152.0; 187343.73333333334; 161.0; 21.6; 0.06666666666666667; 0.4 +1376349649; 1; 2599.999626; 22.533330092; 0.8666666666666667; 2097152.0; 577414.1333333333; 0.0; 2.466666666666667; 0.0; 0.0 +1376349949; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 234878.4; 31.8; 3.6666666666666665; 0.0; 0.0 +1376350249; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 178954.4; 0.8; 2.466666666666667; 0.0; 0.06666666666666667 +1376350549; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 142605.6; 0.0; 1.7333333333333334; 0.0; 0.0 +1376350849; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376351149; 1; 2599.999626; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.2; 0.06666666666666667; 0.0 +1376351449; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 141206.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376351749; 1; 2599.999626; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376352049; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 82485.86666666667; 1.4666666666666666; 1.6666666666666667; 0.0; 0.0 +1376352349; 1; 2599.999626; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376352649; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 178954.13333333333; 3.8666666666666667; 2.7333333333333334; 0.06666666666666667; 0.5333333333333333 +1376352949; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 141206.4; 0.0; 1.0; 0.0; 0.0 +1376353249; 1; 2599.999626; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376353549; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.0; 0.0 +1376353849; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.6; 12.4; 0.0; 0.0 +1376354149; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 192936.0; 12.733333333333333; 13.266666666666667; 0.3333333333333333; 0.13333333333333333 +1376354449; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 130022.4; 0.0; 1.6666666666666667; 0.06666666666666667; 0.0 +1376354749; 1; 2599.999626; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.4; 0.0; 0.0 +1376355049; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376355349; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 134216.0; 0.0; 1.2; 0.0; 0.0 +1376355649; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 135614.93333333332; 0.0; 1.1333333333333333; 0.0; 0.0 +1376355949; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376356249; 1; 2599.999626; 13.866664671999999; 0.5333333333333333; 2097152.0; 138410.66666666666; 0.0; 2.8; 0.06666666666666667; 0.4666666666666667 +1376356549; 1; 2599.999626; 12.133331587999999; 0.4666666666666666; 2097152.0; 121633.33333333333; 0.0; 2.066666666666667; 0.0; 0.0 +1376356849; 1; 2599.999626; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.2; 0.06666666666666667; 0.0 +1376357149; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1376357449; 1; 2599.999626; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376357749; 1; 2599.999626; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1376358049; 1; 2599.999626; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1376358349; 1; 2599.999626; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1376358649; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 1.2; 0.0; 0.0 +1376358949; 1; 2599.999626; 0.0; 0.0; 2097152.0; 60115.73333333333; 0.0; 1.4666666666666666; 0.0; 0.0 +1376359250; 1; 2599.999626; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376359550; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 138411.2; 0.0; 7.4; 0.2; 0.13333333333333333 +1376359850; 1; 2599.999626; 10.399998504000001; 0.4; 2097152.0; 160780.53333333333; 0.0; 2.6; 0.06666666666666667; 0.4666666666666667 +1376360150; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376360450; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1376360750; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376361050; 1; 2599.999626; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.06666666666666667; 0.0 +1376361350; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 1.2; 0.0; 0.0 +1376361650; 1; 2599.999626; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.4; 0.06666666666666667; 0.0 +1376361950; 1; 2599.999626; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 1.4666666666666666; 0.0; 0.0 +1376362250; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376362550; 1; 2599.999626; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376362849; 1; 2599.999626; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.0; 0.0; 0.0 +1376363149; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1376363449; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 169168.53333333333; 0.06666666666666667; 2.933333333333333; 0.06666666666666667; 0.4666666666666667 +1376363749; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 137013.06666666668; 0.0; 1.2666666666666666; 0.0; 0.0 +1376364049; 1; 2599.999626; 0.0; 0.0; 2097152.0; 123030.93333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1376364349; 1; 2599.999626; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.2; 0.0; 0.0 +1376364650; 1; 2599.999626; 0.0; 0.0; 2097152.0; 135614.66666666666; 0.0; 1.3333333333333333; 0.0; 0.0 +1376364950; 1; 2599.999626; 0.0; 0.0; 2097152.0; 111846.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376365250; 1; 2599.999626; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.2; 0.0; 0.0 +1376365550; 1; 2599.999626; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.5333333333333334; 0.0; 0.0 +1376365850; 1; 2599.999626; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.3333333333333333; 0.0; 0.0 +1376366150; 1; 2599.999626; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 1.4666666666666666; 0.0; 0.0 +1376366450; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 111846.66666666667; 0.06666666666666667; 7.466666666666667; 0.2; 0.13333333333333333 +1376366750; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1376367050; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 2.6; 0.4; 0.5333333333333333 +1376367350; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 139809.33333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1376367650; 1; 2599.999626; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376367950; 1; 2599.999626; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.2; 0.0; 0.0 +1376368250; 1; 2599.999626; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376368550; 1; 2599.999626; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1376368850; 1; 2599.999626; 0.0; 0.0; 2097152.0; 144002.93333333332; 0.0; 1.6; 0.0; 0.0 +1376369150; 1; 2599.999626; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376369450; 1; 2599.999626; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.1333333333333333; 0.26666666666666666; 0.0 +1376369750; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 75495.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376370050; 1; 2599.999626; 0.0; 0.0; 2097152.0; 58717.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1376370350; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 1.3333333333333333; 0.0; 0.0 +1376370650; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 142604.0; 0.06666666666666667; 3.066666666666667; 0.06666666666666667; 0.4666666666666667 +1376370950; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 1.3333333333333333; 0.6666666666666666; 0.0 +1376371250; 1; 2599.999626; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.2; 0.2; 0.0 +1376371550; 1; 2599.999626; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376371850; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 167770.13333333333; 0.0; 7.066666666666666; 0.3333333333333333; 0.13333333333333333 +1376372150; 1; 2599.999626; 0.0; 0.0; 2097152.0; 139808.8; 0.0; 1.2; 0.0; 0.0 +1376372450; 1; 2599.999626; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376372750; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 1.4; 0.0; 0.0 +1376373050; 1; 2599.999626; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.5333333333333334; 0.0; 0.0 +1376373350; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 125827.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1376373651; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 1.2; 0.0; 0.0 +1376373951; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376374251; 1; 2599.999626; 10.399998504000001; 0.4; 2097152.0; 163575.46666666667; 0.06666666666666667; 2.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1376374551; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 128623.73333333334; 0.0; 1.2; 0.0; 0.0 +1376374851; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376375151; 1; 2599.999626; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1376375451; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1376375751; 1; 2599.999626; 12.133331587999999; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 3.0; 0.13333333333333333; 0.13333333333333333 +1376376051; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 142604.8; 0.0; 2.066666666666667; 0.06666666666666667; 0.0 +1376376351; 1; 2599.999626; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376376651; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 127225.33333333333; 0.0; 1.2; 0.0; 0.0 +1376376951; 1; 2599.999626; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.4; 0.0; 0.0 +1376377251; 1; 2599.999626; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1376377551; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376377851; 1; 2599.999626; 12.133331587999999; 0.4666666666666666; 2097152.0; 180353.6; 0.6; 2.6666666666666665; 0.13333333333333333; 0.4666666666666667 +1376378151; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 99263.46666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1376378451; 1; 2599.999626; 10.399998504000001; 0.4; 2097152.0; 116041.06666666667; 0.0; 7.333333333333333; 0.2; 0.13333333333333333 +1376378751; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376379051; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376379351; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1376379651; 1; 2599.999626; 0.0; 0.0; 2097152.0; 118836.53333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1376379951; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 2.0; 0.0; 0.0 +1376380251; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376380551; 1; 2599.999626; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376380851; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 131420.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376381151; 1; 2599.999626; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1376381451; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 144003.73333333334; 0.0; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1376381751; 1; 2599.999626; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.2; 0.06666666666666667; 0.0 +1376382051; 1; 2599.999626; 0.0; 0.0; 2097152.0; 138409.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1376382351; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 1.2; 0.0; 0.0 +1376382651; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 81087.73333333334; 0.0; 1.4; 0.0; 0.0 +1376382951; 1; 2599.999626; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376383251; 1; 2599.999626; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 1.2; 0.0; 0.0 +1376383551; 1; 2599.999626; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376383851; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.4; 0.0; 0.0 +1376384151; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1376384451; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.2; 0.0; 0.0 +1376384752; 1; 2599.999626; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376385052; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1376385352; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 111846.66666666667; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376385652; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 95069.06666666667; 0.0; 7.0; 1.0666666666666667; 0.2 +1376385952; 1; 2599.999626; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376386252; 1; 2599.999626; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1376386552; 1; 2599.999626; 0.0; 0.0; 2097152.0; 127225.86666666667; 0.0; 1.2; 0.0; 0.0 +1376386852; 1; 2599.999626; 0.0; 0.0; 2097152.0; 132818.4; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376387152; 1; 2599.999626; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1376387452; 1; 2599.999626; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.2; 0.0 +1376387752; 1; 2599.999626; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 1.2; 0.0; 0.0 +1376388052; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1376388352; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376388652; 1; 2599.999626; 10.399998504000001; 0.4; 2097152.0; 169168.26666666666; 0.0; 2.933333333333333; 0.06666666666666667; 0.4666666666666667 +1376388952; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 1.2; 0.0; 0.0 +1376389252; 1; 2599.999626; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1376389552; 1; 2599.999626; 3.4666661679999997; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 1.4; 0.0; 0.0 +1376389852; 1; 2599.999626; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376390152; 1; 2599.999626; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376390452; 1; 2599.999626; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376390752; 1; 2599.999626; 5.1999992520000005; 0.2; 2097152.0; 97865.33333333333; 0.0; 1.4666666666666666; 0.0; 0.0 +1376391052; 1; 2599.999626; 1.7333330839999999; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1376391352; 1; 2599.999626; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376391652; 1; 2599.999626; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1376391952; 1; 2599.999626; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.2; 0.0; 0.0 +1376392252; 1; 2599.999626; 6.933332335999999; 0.26666666666666666; 2097152.0; 191537.33333333334; 0.0; 2.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1376392552; 1; 2599.999626; 8.666665420000001; 0.33333333333333337; 2097152.0; 163576.0; 0.0; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1376392853; 1; 2599.999626; 0.0; 0.0; 2097152.0; 138409.6; 0.0; 1.2; 0.13333333333333333; 0.0 +1376393153; 1; 2599.999602; 38.999994029999996; 1.5; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1376393453; 1; 2599.999602; 20.799996815999997; 0.8; 2097152.0; 109049.6; 0.0; 1.5333333333333334; 0.0; 0.0 +1376393753; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 93670.93333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376394053; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 107652.26666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1376394353; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 111846.66666666667; 0.0; 1.6666666666666667; 0.0; 0.0 +1376394653; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 75495.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376394953; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 60115.73333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376395253; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 110448.53333333334; 0.0; 1.2; 0.0; 0.0 +1376395552; 1; 2599.999602; 19.066663748; 0.7333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.3333333333333333; 0.0; 0.0 +1376395852; 1; 2599.999602; 19.066663748; 0.7333333333333333; 2097152.0; 113244.8; 0.0; 2.6; 0.06666666666666667; 0.4666666666666667 +1376396152; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 103457.86666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1376396452; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 116041.06666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1376396752; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 117439.2; 0.0; 1.2; 0.0; 0.0 +1376397052; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1376397352; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376397652; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 97865.33333333333; 0.0; 12.533333333333333; 0.0; 0.0 +1376397952; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 81087.73333333334; 0.0; 1.5333333333333334; 0.0; 0.0 +1376398252; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376398552; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 100661.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1376398853; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 7.2; 7.2; 0.13333333333333333 +1376399153; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 155188.0; 0.0; 1.4; 0.0; 0.0 +1376399453; 1; 2599.999602; 22.533329884; 0.8666666666666667; 2097152.0; 178955.46666666667; 0.0; 2.6666666666666665; 0.06666666666666667; 0.5333333333333333 +1376399753; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1376400053; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376400353; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 74097.06666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1376400653; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 92272.8; 0.0; 1.6666666666666667; 0.0; 0.0 +1376400953; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 88078.4; 0.0; 2.0; 0.0; 0.0 +1376401253; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 69902.66666666667; 0.0; 1.2; 0.0; 0.0 +1376401553; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1376401853; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 130022.4; 0.0; 1.4; 0.0; 0.0 +1376402153; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 1.2; 0.0; 0.0 +1376402453; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 1.2666666666666666; 0.0; 0.0 +1376402753; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 83884.0; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376403053; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 113244.8; 0.0; 3.1333333333333333; 0.0; 0.4666666666666667 +1376403353; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 113244.8; 0.0; 1.3333333333333333; 0.0; 0.0 +1376403653; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376403953; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 93670.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376404253; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 74097.06666666667; 0.0; 1.2; 0.06666666666666667; 0.0 +1376404553; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 90874.66666666667; 0.06666666666666667; 2.066666666666667; 0.06666666666666667; 0.13333333333333333 +1376404853; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 92272.8; 0.0; 1.2666666666666666; 0.0; 0.0 +1376405153; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 65708.26666666666; 0.0; 1.3333333333333333; 0.0; 0.0 +1376405453; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1376405753; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 106254.13333333333; 0.0; 7.4; 0.2; 0.13333333333333333 +1376406053; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 83884.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376406353; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 135614.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1376406653; 1; 2599.999602; 74.53332192399999; 2.8666666666666667; 2097152.0; 630542.1333333333; 161.13333333333333; 23.266666666666666; 0.06666666666666667; 0.8666666666666667 +1376406954; 1; 2599.999602; 19.066663748; 0.7333333333333333; 2097152.0; 369096.8; 0.3333333333333333; 20.2; 0.0; 0.0 +1376407254; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 237674.93333333332; 31.8; 3.933333333333333; 0.0; 0.0 +1376407554; 1; 2599.999602; 19.066663748; 0.7333333333333333; 2097152.0; 141207.46666666667; 4.266666666666667; 2.533333333333333; 0.06666666666666667; 0.0 +1376407854; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 96467.2; 0.0; 1.7333333333333334; 0.0; 0.0 +1376408154; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376408454; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 132818.66666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376408754; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.5333333333333334; 0.2; 0.0 +1376409054; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376409354; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1376409654; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 81087.73333333334; 0.0; 1.2; 0.0; 0.0 +1376409954; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376410254; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 149595.46666666667; 0.0; 2.8; 0.06666666666666667; 0.4666666666666667 +1376410554; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 114642.93333333333; 0.0; 1.2; 0.0; 0.0 +1376410854; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376411154; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 102059.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1376411454; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 109050.4; 0.0; 1.4; 0.0; 0.0 +1376411754; 1; 2599.999602; 20.799996815999997; 0.8; 2097152.0; 100661.6; 12.733333333333333; 13.466666666666667; 0.3333333333333333; 0.2 +1376412054; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 128624.26666666666; 0.0; 1.6666666666666667; 0.0; 0.0 +1376412354; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376412654; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 1.2; 0.0; 0.0 +1376412954; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 1.2; 0.0; 0.0 +1376413255; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 90874.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376413555; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 74097.06666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376413855; 1; 2599.999602; 20.799996815999997; 0.8; 2097152.0; 138409.6; 0.06666666666666667; 2.8; 0.06666666666666667; 0.4666666666666667 +1376414155; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 96467.2; 0.0; 1.4666666666666666; 0.0; 0.0 +1376414455; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376414755; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1376415055; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1376415355; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 95069.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376415655; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 93670.93333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376415955; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376416255; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376416555; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.0; 0.0 +1376416855; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 82485.86666666667; 1.0666666666666667; 1.9333333333333333; 0.0; 0.0 +1376417155; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.4666666666666666; 0.0; 0.0 +1376417455; 1; 2599.999602; 20.799996815999997; 0.8; 2097152.0; 195732.26666666666; 0.0; 2.4; 0.0; 0.5333333333333333 +1376417755; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376418055; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.0; 0.0 +1376418355; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 7.333333333333333; 0.26666666666666666; 0.2 +1376418655; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1376418955; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 117438.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1376419255; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1376419555; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 118836.53333333334; 0.0; 1.2; 0.0; 0.0 +1376419855; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 64310.13333333333; 0.0; 1.4666666666666666; 0.0; 0.0 +1376420155; 1; 2599.999602; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 1.2; 0.0; 0.0 +1376420455; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 1.6; 0.0; 0.06666666666666667 +1376420755; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376421055; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 202721.86666666667; 0.0; 2.8666666666666667; 0.06666666666666667; 0.5333333333333333 +1376421355; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 100661.6; 0.0; 1.4666666666666666; 0.0; 0.0 +1376421655; 1; 2599.999602; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376421955; 1; 2599.999602; 45.066659768; 1.7333333333333334; 2097152.0; 360707.73333333334; 161.73333333333332; 14.466666666666667; 0.0; 0.2 +1376422255; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 282414.4; 0.0; 1.5333333333333334; 0.0; 0.0 +1376422555; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 194334.13333333333; 31.8; 3.8666666666666667; 0.0; 0.0 +1376422856; 1; 2599.999602; 0.0; 0.0; 2097152.0; 137012.26666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1376423156; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1376423456; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.0; 0.0 +1376423756; 1; 2599.999602; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.2; 0.0; 0.0 +1376424056; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.0; 1.3333333333333333; 0.0; 0.0 +1376424356; 1; 2599.999602; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.2; 0.0; 0.0 +1376424656; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 153790.13333333333; 0.06666666666666667; 8.933333333333334; 0.26666666666666666; 0.6 +1376424956; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 127226.13333333333; 0.0; 1.0; 0.0; 0.0 +1376425256; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 82485.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376425556; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.2; 0.0; 0.0 +1376425856; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 99263.46666666666; 0.0; 1.2; 0.0; 0.0 +1376426156; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 1.2; 0.0; 0.0 +1376426456; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 83884.0; 0.0; 1.4; 0.0; 0.0 +1376426756; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 82485.86666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1376427056; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 100661.6; 0.0; 1.0; 0.06666666666666667; 0.0 +1376427356; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1376427656; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.2; 0.06666666666666667; 0.0 +1376427956; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376428256; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 199926.4; 0.06666666666666667; 3.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376428556; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 163576.8; 0.0; 1.3333333333333333; 0.0; 0.0 +1376428856; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1376429156; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1376429456; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 1.2; 0.0; 0.0 +1376429756; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 74097.06666666667; 0.0; 1.2; 0.0; 0.0 +1376430056; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1376430356; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 134216.0; 0.0; 1.3333333333333333; 0.0; 0.0 +1376430656; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 1.3333333333333333; 0.0; 0.0 +1376430956; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 1.5333333333333334; 0.0; 0.0 +1376431256; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 121633.6; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1376431556; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 125828.0; 0.0; 1.2; 0.0; 0.0 +1376431856; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 131420.53333333333; 0.0; 2.6; 0.06666666666666667; 0.4666666666666667 +1376432156; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.4; 0.0; 0.0 +1376432456; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 92272.8; 0.0; 1.4; 0.0; 0.0 +1376432756; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376433056; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 131419.73333333334; 0.06666666666666667; 2.7333333333333334; 0.0; 0.0 +1376433356; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 137013.06666666668; 0.0; 1.6666666666666667; 0.4666666666666667; 0.13333333333333333 +1376433656; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 92272.8; 0.0; 1.4; 0.0; 0.0 +1376433956; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376434256; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 1.2; 0.0; 0.0 +1376434556; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1376434856; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 79689.6; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376435156; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 103457.86666666667; 0.0; 1.6; 0.0; 0.0 +1376435456; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 178955.46666666667; 0.13333333333333333; 3.066666666666667; 0.06666666666666667; 0.4666666666666667 +1376435756; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376436056; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 137013.06666666668; 0.0; 1.2; 0.0; 0.0 +1376436356; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 1.4; 0.0; 0.0 +1376436656; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376436956; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376437256; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 1.4; 0.0; 0.0 +1376437556; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 97865.33333333333; 0.06666666666666667; 7.8; 0.3333333333333333; 0.13333333333333333 +1376437856; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.5333333333333334; 0.0; 0.0 +1376438156; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376438456; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376438756; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 93670.93333333333; 0.0; 1.2; 0.0; 0.0 +1376439056; 1; 2599.999602; 15.599997612; 0.6; 2097152.0; 197130.4; 0.0; 2.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1376439356; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 118836.53333333334; 0.0; 1.2; 0.0; 0.0 +1376439656; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376439956; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 93670.93333333333; 0.0; 1.3333333333333333; 0.2; 0.0 +1376440256; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 67106.4; 0.0; 1.8; 0.0; 0.0 +1376440557; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 69902.66666666667; 0.0; 1.4; 0.0; 0.0 +1376440857; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 75495.2; 0.0; 1.2; 0.0; 0.0 +1376441157; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 81087.73333333334; 0.0; 12.0; 0.06666666666666667; 0.0 +1376441457; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1376441757; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1376442057; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 134216.0; 0.0; 1.3333333333333333; 0.0; 0.0 +1376442357; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1376442657; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 180353.6; 0.0; 2.4; 0.06666666666666667; 0.5333333333333333 +1376442957; 1; 2599.99945; 31.777771055555554; 1.2222222222222223; 2097152.0; 97865.33333333333; 0.0; 0.625; 0.0; 0.0 +1376443257; 1; 2599.99945; 8.666664833333334; 0.33333333333333337; 2097152.0; 156585.33333333334; 0.0; 7.2; 0.3333333333333333; 0.13333333333333333 +1376443557; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 146800.0; 0.0; 1.2; 0.0; 0.0 +1376443857; 1; 2599.99945; 3.466665933333333; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 1.2; 0.0; 0.0 +1376444157; 1; 2599.99945; 6.933331866666666; 0.26666666666666666; 2097152.0; 114642.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1376444457; 1; 2599.99945; 12.133330766666665; 0.4666666666666666; 2097152.0; 148197.33333333334; 0.0; 1.2; 0.06666666666666667; 0.0 +1376444757; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 142604.8; 0.0; 1.4666666666666666; 0.0; 0.0 +1376445057; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1376445357; 1; 2599.99945; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376445657; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 96467.2; 0.0; 1.8666666666666667; 10.933333333333334; 0.0 +1376445957; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376446257; 1; 2599.99945; 10.3999978; 0.4; 2097152.0; 134216.0; 0.0; 2.933333333333333; 0.06666666666666667; 0.4666666666666667 +1376446557; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 138411.2; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376446857; 1; 2599.99945; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1376447157; 1; 2599.99945; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376447457; 1; 2599.99945; 8.666664833333334; 0.33333333333333337; 2097152.0; 141206.66666666666; 0.0; 1.2; 0.06666666666666667; 0.0 +1376447757; 1; 2599.99945; 8.666664833333334; 0.33333333333333337; 2097152.0; 153789.6; 0.0; 1.2; 0.13333333333333333; 0.0 +1376448057; 1; 2599.99945; 3.466665933333333; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1376448357; 1; 2599.99945; 3.466665933333333; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.0; 0.0 +1376448657; 1; 2599.99945; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376448957; 1; 2599.99945; 10.3999978; 0.4; 2097152.0; 103457.86666666667; 0.0; 1.6; 0.3333333333333333; 0.0 +1376449257; 1; 2599.99945; 12.133330766666665; 0.4666666666666666; 2097152.0; 90874.66666666667; 0.0; 1.2; 0.0; 0.0 +1376449558; 1; 2599.99945; 8.666664833333334; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1376449858; 1; 2599.99945; 15.599996699999998; 0.6; 2097152.0; 152390.93333333332; 0.06666666666666667; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1376450158; 1; 2599.99945; 12.133330766666665; 0.4666666666666666; 2097152.0; 137012.8; 0.0; 7.333333333333333; 0.26666666666666666; 0.13333333333333333 +1376450458; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 132818.66666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1376450758; 1; 2599.99945; 6.933331866666666; 0.26666666666666666; 2097152.0; 149595.46666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376451058; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 110448.53333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1376451358; 1; 2599.99945; 3.466665933333333; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1376451658; 1; 2599.99945; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 1.6666666666666667; 0.0; 0.0 +1376451958; 1; 2599.99945; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.4; 0.0; 0.0 +1376452258; 1; 2599.99945; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376452558; 1; 2599.99945; 3.466665933333333; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376452858; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376453158; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 102059.73333333334; 0.0; 1.4666666666666666; 0.0; 0.0 +1376453458; 1; 2599.99945; 13.866663733333333; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 2.6; 0.2; 0.4666666666666667 +1376453758; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 104856.0; 0.0; 1.3333333333333333; 0.0; 0.0 +1376454058; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376454358; 1; 2599.99945; 3.466665933333333; 0.13333333333333333; 2097152.0; 76893.33333333333; 0.0; 1.2; 0.0; 0.0 +1376454658; 1; 2599.99945; 3.466665933333333; 0.13333333333333333; 2097152.0; 67106.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376454958; 1; 2599.99945; 6.933331866666666; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 1.2; 0.0; 0.0 +1376455258; 1; 2599.99945; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376455558; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 89476.53333333334; 0.0; 6.933333333333334; 0.3333333333333333; 0.2 +1376455858; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 116041.06666666667; 0.0; 2.1333333333333333; 0.0; 0.0 +1376456158; 1; 2599.99945; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.3333333333333333; 0.0; 0.0 +1376456458; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 90874.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376456758; 1; 2599.99945; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.2; 0.0; 0.0 +1376457058; 1; 2599.99945; 6.933331866666666; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 2.533333333333333; 0.0; 0.4666666666666667 +1376457359; 1; 2599.99945; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376457659; 1; 2599.99945; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376457959; 1; 2599.99945; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376458259; 1; 2599.99945; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376458559; 1; 2599.99945; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.5333333333333334; 0.06666666666666667; 0.0 +1376458859; 1; 2599.99945; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376459159; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376459459; 1; 2599.99945; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376459759; 1; 2599.99945; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.0; 0.0 +1376460059; 1; 2599.99945; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 1.4; 0.0; 0.0 +1376460359; 1; 2599.99945; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.3333333333333333; 1.6; 0.0 +1376460659; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 150993.6; 0.06666666666666667; 2.8; 0.06666666666666667; 0.4666666666666667 +1376460959; 1; 2599.99945; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376461258; 1; 2599.99945; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.2; 0.0; 0.0 +1376461558; 1; 2599.99945; 3.466665933333333; 0.13333333333333333; 2097152.0; 75495.2; 0.06666666666666667; 6.8; 0.26666666666666666; 0.2 +1376461858; 1; 2599.99945; 124.79997359999999; 4.8; 2097152.0; 524285.86666666664; 161.46666666666667; 170.26666666666668; 20.866666666666667; 1.0666666666666667 +1376462158; 1; 2599.99945; 17.333329666666668; 0.6666666666666667; 2097152.0; 541063.2; 5.066666666666666; 12.2; 0.13333333333333333; 0.06666666666666667 +1376462458; 1; 2599.99945; 15.599996699999998; 0.6; 2097152.0; 243267.2; 31.8; 4.6; 0.06666666666666667; 0.0 +1376462758; 1; 2599.99945; 6.933331866666666; 0.26666666666666666; 2097152.0; 187343.2; 0.0; 2.8666666666666667; 0.0; 0.0 +1376463059; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 123030.93333333333; 0.0; 2.066666666666667; 0.0; 0.0 +1376463359; 1; 2599.99945; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.2; 0.06666666666666667; 0.0 +1376463659; 1; 2599.99945; 20.7999956; 0.8; 2097152.0; 116041.06666666667; 0.0; 1.2; 0.0; 0.0 +1376463959; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376464259; 1; 2599.999602; 28.599995622; 1.1; 2097152.0; 188740.0; 0.0; 1.4444444444444444; 0.1111111111111111; 0.0 +1376464559; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 125827.46666666666; 0.0; 1.2; 0.06666666666666667; 0.0 +1376464859; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 109050.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1376465159; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376465459; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 92272.8; 0.0; 1.5333333333333334; 0.0; 0.0 +1376465759; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376466059; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376466359; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 125828.0; 0.0; 1.6; 0.0; 0.0 +1376466659; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 138411.2; 0.0; 1.2; 0.0; 0.0 +1376466959; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 124429.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376467259; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 107651.46666666666; 0.0; 1.2; 0.0; 0.0 +1376467559; 1; 2599.999602; 0.0; 0.0; 2097152.0; 125827.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376467859; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 152391.73333333334; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1376468159; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376468459; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 131420.53333333333; 0.0; 7.4; 0.26666666666666666; 0.13333333333333333 +1376468759; 1; 2599.999602; 0.0; 0.0; 2097152.0; 125827.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1376469059; 1; 2599.999602; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376469359; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376469659; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 1.6; 0.0; 0.0 +1376469959; 1; 2599.999602; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376470259; 1; 2599.999602; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376470559; 1; 2599.999602; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376470859; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.3333333333333333; 0.9333333333333333; 0.0 +1376471159; 1; 2599.999602; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376471459; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 159381.6; 0.06666666666666667; 2.8; 0.13333333333333333; 0.4666666666666667 +1376471759; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.2; 0.0; 0.0 +1376472059; 1; 2599.999602; 0.0; 0.0; 2097152.0; 62912.0; 0.0; 1.2; 0.0; 0.0 +1376472359; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 72698.93333333333; 0.0; 1.4; 0.0; 0.0 +1376472659; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376472959; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 150993.6; 20.6; 2.2666666666666666; 0.0; 0.06666666666666667 +1376473260; 1; 2599.999602; 20.799996815999997; 0.8; 2097152.0; 114642.93333333333; 0.0; 4.2; 0.0; 0.0 +1376473560; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 110448.53333333334; 0.0; 2.933333333333333; 0.0; 0.0 +1376473860; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 142604.53333333333; 12.733333333333333; 13.666666666666666; 0.26666666666666666; 0.13333333333333333 +1376474160; 1; 2599.999602; 0.0; 0.0; 2097152.0; 139808.53333333333; 0.0; 1.4666666666666666; 0.0; 0.0 +1376474460; 1; 2599.999602; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376474760; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 131420.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376475060; 1; 2599.999602; 12.133331475999999; 0.4666666666666666; 2097152.0; 162177.86666666667; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1376475360; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 130021.6; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1376475660; 1; 2599.999602; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1376475960; 1; 2599.999602; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376476260; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 127226.13333333333; 0.0; 1.2; 0.0; 0.0 +1376476560; 1; 2599.999602; 0.0; 0.0; 2097152.0; 113244.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1376476860; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1376477160; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1376477460; 1; 2599.999602; 0.0; 0.0; 2097152.0; 148197.06666666668; 0.0; 1.1333333333333333; 0.0; 0.0 +1376477760; 1; 2599.99945; 31.199993399999997; 1.2; 2097152.0; 134216.8; 0.0; 1.2222222222222223; 0.0; 0.0 +1376478060; 1; 2599.99945; 13.866663733333333; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 1.4; 0.0; 0.0 +1376478360; 1; 2599.99945; 15.599996699999998; 0.6; 2097152.0; 93670.93333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376478660; 1; 2599.99945; 12.133330766666665; 0.4666666666666666; 2097152.0; 174760.0; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1376478960; 1; 2599.99945; 12.133330766666665; 0.4666666666666666; 2097152.0; 121632.8; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376479260; 1; 2599.99945; 17.333329666666668; 0.6666666666666667; 2097152.0; 96467.2; 0.0; 1.6; 0.06666666666666667; 0.0 +1376479560; 1; 2599.99945; 6.933331866666666; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1376479860; 1; 2599.99945; 8.666664833333334; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 7.333333333333333; 0.26666666666666666; 0.13333333333333333 +1376480160; 1; 2599.99945; 10.3999978; 0.4; 2097152.0; 124429.06666666667; 0.0; 1.2; 0.0; 0.0 +1376480460; 1; 2599.999343; 37.55554606555556; 1.4444444444444446; 2097152.0; 83884.0; 0.0; 1.0; 0.0; 0.0 +1376480760; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.8; 0.06666666666666667; 0.0 +1376481060; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1376481360; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1376481660; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 113244.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1376481960; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 92272.8; 0.0; 1.4; 0.0; 0.0 +1376482261; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 142604.0; 0.0; 2.533333333333333; 0.0; 0.4666666666666667 +1376482561; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 92272.8; 0.0; 1.2666666666666666; 0.0; 0.0 +1376482861; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 1.2; 0.0; 0.0 +1376483161; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376483461; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 1.6; 0.0; 0.0 +1376483761; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 86680.26666666666; 0.0; 1.2; 0.0; 0.0 +1376484061; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 83884.0; 0.0; 1.2; 0.0; 0.0 +1376484361; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 81087.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1376484661; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 116041.06666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376484961; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 79689.6; 0.0; 12.266666666666667; 0.0; 0.0 +1376485261; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 142605.6; 0.06666666666666667; 7.6; 0.2; 0.13333333333333333 +1376485561; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 130021.6; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376485861; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 166371.46666666667; 0.06666666666666667; 2.7333333333333334; 0.0; 0.4666666666666667 +1376486161; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 113244.8; 0.0; 1.5333333333333334; 0.0; 0.0 +1376486461; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1376486761; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376487061; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 79689.6; 0.0; 1.2; 0.0; 0.0 +1376487361; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1376487661; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130021.6; 0.0; 1.6; 0.0; 0.0 +1376487961; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 97865.33333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376488261; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 102059.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1376488561; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 134216.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376488861; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 163576.8; 1.8; 1.5333333333333334; 0.0; 0.06666666666666667 +1376489161; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376489461; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 148197.33333333334; 0.0; 2.3333333333333335; 0.0; 0.5333333333333333 +1376489761; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376490061; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 109050.4; 0.0; 1.8; 0.06666666666666667; 0.0 +1376490362; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 121633.6; 0.0; 1.4; 0.0; 0.0 +1376490662; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 142605.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376490962; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 130022.4; 0.0; 7.6; 0.26666666666666666; 0.26666666666666666 +1376491262; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376491562; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376491862; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 125827.2; 0.0; 1.3333333333333333; 0.13333333333333333; 0.0 +1376492162; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1376492462; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 83884.0; 0.0; 1.2666666666666666; 0.13333333333333333; 0.0 +1376492762; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1376493062; 1; 2599.999343; 24.266660534666663; 0.9333333333333332; 2097152.0; 162177.86666666667; 0.0; 2.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1376493362; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 121632.8; 0.0; 1.2666666666666666; 0.0; 0.0 +1376493662; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376493962; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 75495.2; 0.0; 1.0; 2.4; 0.0 +1376494261; 1; 2599.999309; 25.999993089999997; 1.0; 2097152.0; 71300.8; 0.0; 1.1111111111111112; 0.0; 0.0 +1376494561; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1376494861; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376495161; 1; 2599.999309; 17.333328726666668; 0.6666666666666667; 2097152.0; 86680.26666666666; 0.0; 1.5333333333333334; 0.0; 0.0 +1376495461; 1; 2599.999309; 20.799994471999998; 0.8; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1376495761; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.2; 0.06666666666666667; 0.0 +1376496061; 1; 2599.999309; 17.333328726666668; 0.6666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376496362; 1; 2599.999309; 20.799994471999998; 0.8; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376496662; 1; 2599.999309; 20.799994471999998; 0.8; 2097152.0; 163575.2; 0.2; 2.8666666666666667; 0.13333333333333333; 0.5333333333333333 +1376496962; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 93670.93333333333; 0.0; 7.466666666666667; 0.3333333333333333; 0.13333333333333333 +1376497262; 1; 2599.999309; 20.799994471999998; 0.8; 2097152.0; 120235.46666666666; 0.0; 1.6; 0.0; 0.0 +1376497562; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 72698.93333333333; 0.0; 1.2; 0.0; 0.0 +1376497862; 1; 2599.999309; 19.06666159933333; 0.7333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376498162; 1; 2599.999309; 20.799994471999998; 0.8; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376498462; 1; 2599.999297; 29.249992091249997; 1.125; 2097152.0; 76019.5; 0.0; 1.0; 0.0; 0.0 +1376498762; 1; 2599.999297; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1376499062; 1; 2599.999297; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1376499362; 1; 2599.999297; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1376499662; 1; 2599.999297; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376499962; 1; 2599.999297; 5.199998594; 0.2; 2097152.0; 86680.26666666666; 0.0; 1.4; 0.0; 0.0 +1376500262; 1; 2599.999297; 6.933331458666666; 0.26666666666666666; 2097152.0; 152391.2; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1376500562; 1; 2599.999297; 0.0; 0.0; 2097152.0; 117438.93333333333; 0.0; 1.2; 0.2; 0.0 +1376500862; 1; 2599.999297; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376501162; 1; 2599.999297; 8.666664323333334; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 143.66666666666666; 0.0 +1376501462; 1; 2599.999297; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.5333333333333334; 0.0; 0.0 +1376501762; 1; 2599.999297; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 1.2666666666666666; 0.26666666666666666; 0.0 +1376502062; 1; 2599.999297; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.4; 0.0; 0.0 +1376502362; 1; 2599.999297; 3.466665729333333; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1376502662; 1; 2599.999297; 3.466665729333333; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 1.2; 8.4; 0.0 +1376502962; 1; 2599.999297; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 1.2; 0.0; 0.0 +1376503263; 1; 2599.999297; 0.0; 0.0; 2097152.0; 113244.26666666666; 0.0; 1.2; 0.0; 0.0 +1376503563; 1; 2599.999297; 5.199998594; 0.2; 2097152.0; 138410.93333333332; 0.0; 7.466666666666667; 0.2; 0.13333333333333333 +1376503863; 1; 2599.999297; 6.933331458666666; 0.26666666666666666; 2097152.0; 169168.0; 0.0; 2.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1376504163; 1; 2599.999297; 0.0; 0.0; 2097152.0; 130022.13333333333; 0.0; 1.6; 0.0; 0.0 +1376504463; 1; 2599.999297; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1376504763; 1; 2599.999297; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376505063; 1; 2599.999297; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.2; 0.0; 0.0 +1376505363; 1; 2599.999297; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376505663; 1; 2599.999297; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.5333333333333334; 0.0; 0.0 +1376505963; 1; 2599.999297; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 1.2; 0.0; 0.0 +1376506263; 1; 2599.999297; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1376506563; 1; 2599.999297; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1376506863; 1; 2599.999297; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.4; 0.0; 0.0 +1376507163; 1; 2599.999297; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376507463; 1; 2599.999297; 5.199998594; 0.2; 2097152.0; 162177.86666666667; 0.06666666666666667; 2.7333333333333334; 0.0; 0.4666666666666667 +1376507763; 1; 2599.999297; 3.466665729333333; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376508063; 1; 2599.999297; 317.19991423399995; 12.2; 2097152.0; 437603.2; 907.8; 1409.7333333333333; 246.6; 7.866666666666666 +1376508363; 1; 2599.999297; 109.199970474; 4.2; 2097152.0; 829071.7333333333; 1.4666666666666666; 6.466666666666667; 0.0; 0.13333333333333333 +1376508663; 1; 2599.999304; 31.199991648; 1.2; 2097152.0; 419428.0; 0.0; 1.7777777777777777; 0.0; 0.0 +1376508963; 1; 2599.999304; 34.66665738666667; 1.3333333333333335; 2097152.0; 321561.86666666664; 0.8; 5.0; 0.0; 0.06666666666666667 +1376509263; 1; 2599.999304; 20.799994432; 0.8; 2097152.0; 223693.33333333334; 0.0; 1.5333333333333334; 0.0; 0.0 +1376509563; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376509863; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 1.0; 0.13333333333333333; 0.0 +1376510163; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 78291.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376510463; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376510763; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 131420.53333333333; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1376511064; 1; 2599.999304; 20.799994432; 0.8; 2097152.0; 201324.8; 17.266666666666666; 2.6; 0.06666666666666667; 0.4666666666666667 +1376511364; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 152391.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376511664; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1376511964; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1376512264; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376512564; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376512864; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1376513164; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1376513464; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376513764; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 75495.2; 0.0; 1.0; 0.0; 0.0 +1376514064; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1376514364; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.6; 0.06666666666666667; 0.0 +1376514664; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 155187.2; 0.0; 2.3333333333333335; 0.0; 0.5333333333333333 +1376514964; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1376515264; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376515564; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376515864; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 134216.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376516164; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1376516464; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376516764; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 75495.2; 0.0; 1.0; 0.0; 0.0 +1376517064; 1; 2599.999304; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376517365; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 121632.8; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1376517665; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121632.8; 0.0; 0.8; 0.0; 0.0 +1376517965; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376518265; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 163576.0; 0.06666666666666667; 2.6; 0.06666666666666667; 0.5333333333333333 +1376518565; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 125827.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376518865; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 0.5333333333333333; 0.0; 0.0 +1376519165; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 0.6; 0.0; 0.0 +1376519465; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 85282.13333333333; 2.7333333333333334; 1.2; 0.0; 0.0 +1376519765; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 127226.13333333333; 0.0; 1.0; 0.06666666666666667; 0.06666666666666667 +1376520065; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 137013.06666666668; 0.0; 0.8; 0.0; 0.0 +1376520365; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376520665; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 121633.6; 0.0; 0.6; 0.0; 0.0 +1376520965; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376521265; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376521565; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 141206.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376521865; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 164974.13333333333; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376522165; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1376522465; 1; 2599.999304; 136.93329667733332; 5.266666666666667; 2097152.0; 171964.0; 161.86666666666667; 14.466666666666667; 0.0; 0.0 +1376522765; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 289404.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376523065; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 170567.46666666667; 31.8; 3.7333333333333334; 0.0; 0.0 +1376523365; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 226490.4; 0.0; 0.8; 0.0; 0.0 +1376523665; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376523965; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 76893.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376524265; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 120235.46666666666; 0.0; 7.0; 0.2; 0.13333333333333333 +1376524565; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 146798.4; 0.0; 0.8; 0.0; 0.0 +1376524865; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376525165; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 1.0; 0.0; 0.0 +1376525465; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 159380.8; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376525765; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 117439.2; 0.06666666666666667; 0.9333333333333333; 0.0; 0.0 +1376526065; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 142605.6; 0.0; 0.8; 0.0; 0.0 +1376526365; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376526665; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.6666666666666666; 1.1333333333333333; 0.0; 0.0 +1376526965; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1376527265; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376527565; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376527865; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1376528165; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1376528465; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 86680.26666666666; 0.0; 11.666666666666666; 0.0; 0.0 +1376528765; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 142604.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1376529065; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 163576.0; 0.06666666666666667; 2.6; 0.06666666666666667; 0.4666666666666667 +1376529365; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376529666; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1376529966; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.6; 0.06666666666666667; 0.0 +1376530266; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 128624.26666666666; 0.06666666666666667; 0.8666666666666667; 0.0; 0.0 +1376530566; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 0.6; 0.0; 0.0 +1376530866; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 159382.4; 0.0; 6.933333333333334; 0.26666666666666666; 0.13333333333333333 +1376531166; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1376531466; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1376531766; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.8; 0.0; 0.0 +1376532066; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376532366; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376532666; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 163575.73333333334; 0.0; 2.066666666666667; 0.0; 0.5333333333333333 +1376532966; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 155188.0; 0.0; 0.8; 0.0; 0.0 +1376533266; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376533566; 1; 2599.999304; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376533866; 1; 2599.999304; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1376534166; 1; 2599.999304; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1376534466; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 116041.06666666667; 0.0; 1.6; 0.0; 0.0 +1376534766; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1376535066; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1376535366; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376535666; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376535966; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1376536266; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 199926.13333333333; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376536566; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 128624.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1376536866; 1; 2599.999304; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.6; 0.0; 0.0 +1376537166; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1376537466; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376537766; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 104856.0; 12.733333333333333; 13.066666666666666; 0.3333333333333333; 0.2 +1376538066; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 155188.8; 0.0; 0.8; 0.0; 0.0 +1376538366; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.4; 0.0; 0.0 +1376538666; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376538967; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 174761.33333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376539267; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117438.13333333333; 0.0; 0.6; 0.0; 0.0 +1376539567; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1376539867; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 174760.53333333333; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1376540167; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 100661.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376540466; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 104856.0; 0.0; 0.5333333333333333; 0.0; 0.0 +1376540766; 1; 2599.999304; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1376541066; 1; 2599.999304; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1376541366; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.6; 0.0; 0.0 +1376541666; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1376541966; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 71300.8; 0.0; 0.5333333333333333; 0.0; 0.0 +1376542267; 1; 2599.999304; 0.0; 0.0; 2097152.0; 110448.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376542567; 1; 2599.999304; 0.0; 0.0; 2097152.0; 148196.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376542867; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1376543167; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376543467; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 188741.33333333334; 0.06666666666666667; 1.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1376543767; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 142605.33333333334; 0.0; 6.8; 0.2; 0.13333333333333333 +1376544067; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.6; 0.0; 0.0 +1376544367; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376544667; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1376544967; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.0; 0.6; 0.0; 0.0 +1376545267; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 106254.13333333333; 0.0; 0.6; 0.0; 0.0 +1376545567; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376545867; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1376546167; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376546467; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376546767; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 103457.86666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1376547067; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 166371.73333333334; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1376547367; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 131420.26666666666; 0.0; 0.8; 0.0; 0.0 +1376547667; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.6; 0.0; 0.0 +1376547967; 1; 2599.999304; 0.0; 0.0; 2097152.0; 118836.53333333334; 0.0; 0.6; 0.0; 0.0 +1376548267; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1376548567; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 159382.4; 0.0; 1.9333333333333333; 0.0; 0.0 +1376548867; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1376549167; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 72698.93333333333; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1376549467; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1376549767; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1376550067; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 153789.06666666668; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1376550367; 1; 2599.999304; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376550667; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 192936.0; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1376550968; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 134216.53333333333; 0.0; 0.6; 0.0; 0.0 +1376551268; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1376551568; 1; 2599.999304; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.6; 0.0; 0.0 +1376551868; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 81087.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376552168; 1; 2599.999304; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.5333333333333333; 0.0; 0.0 +1376552468; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1376552768; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 1.6; 0.0; 0.0 +1376553068; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376553368; 1; 2599.999304; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376553668; 1; 2599.999304; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376553968; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 102059.73333333334; 0.7333333333333333; 1.9333333333333333; 1.2; 0.0 +1376554268; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 159381.86666666667; 0.06666666666666667; 2.6; 0.06666666666666667; 0.4666666666666667 +1376554568; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 155187.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376554868; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376555168; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1376555468; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376555768; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376556068; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1376556368; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 141207.46666666667; 0.0; 6.8; 0.2; 0.13333333333333333 +1376556668; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 150993.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376556968; 1; 2599.999304; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376557268; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 99263.46666666666; 1.5333333333333334; 1.4666666666666666; 0.0; 0.0 +1376557568; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376557868; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 176159.2; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1376558168; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1376558468; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376558768; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 71300.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376559068; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 69902.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376559368; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 71300.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376559668; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 116041.06666666667; 0.0; 1.0; 0.0; 0.0 +1376559968; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 141207.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376560268; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376560568; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376560868; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 130021.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1376561168; 1; 2599.999304; 0.0; 0.0; 2097152.0; 134215.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376561468; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 132818.4; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1376561768; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376562068; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 7.2; 0.26666666666666666; 0.13333333333333333 +1376562368; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376562668; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376562968; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376563269; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1376563569; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1376563869; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376564169; 1; 2599.999304; 195.86661423466666; 7.533333333333334; 2097152.0; 359310.4; 162.26666666666668; 117.66666666666667; 0.0; 0.4 +1376564469; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 655707.7333333333; 0.0; 6.0; 0.06666666666666667; 0.0 +1376564769; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 292200.8; 31.8; 3.466666666666667; 0.0; 0.0 +1376565069; 1; 2599.999304; 24.266660170666665; 0.9333333333333332; 2097152.0; 255850.4; 18.0; 3.933333333333333; 0.7333333333333333; 0.4666666666666667 +1376565369; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 169168.26666666666; 0.0; 1.5333333333333334; 0.0; 0.0 +1376565669; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.6; 0.06666666666666667; 0.0 +1376565969; 1; 2599.999304; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376566269; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 121633.33333333333; 0.0; 0.6; 0.06666666666666667; 0.0 +1376566569; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376566869; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1376567169; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376567469; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376567769; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376568069; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.5333333333333333; 0.0; 0.0 +1376568369; 1; 2599.999304; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376568669; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 211111.2; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1376568969; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 149595.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376569269; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 7.333333333333333; 0.26666666666666666; 0.2 +1376569569; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1376569869; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 0.6; 0.0; 0.0 +1376570169; 1; 2599.999304; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376570469; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 92272.8; 0.0; 1.0; 0.06666666666666667; 0.0 +1376570769; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376571069; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376571369; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.3333333333333333; 0.0 +1376571669; 1; 2599.999304; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376571969; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 79689.6; 0.0; 11.6; 0.0; 0.0 +1376572269; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 141207.2; 1.0; 3.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376572569; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 132818.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376572869; 1; 2599.999304; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.6; 0.0; 0.0 +1376573169; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376573469; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1376573769; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376574069; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1376574369; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376574669; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 72698.93333333333; 0.0; 1.0; 0.0; 0.0 +1376574969; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376575269; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1376575569; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 137013.06666666668; 0.0; 0.6; 0.0; 0.0 +1376575869; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 163576.0; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1376576169; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 155188.0; 0.06666666666666667; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1376576469; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 121633.6; 0.0; 0.8; 0.13333333333333333; 0.0 +1376576769; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.3333333333333333; 0.0 +1376577069; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.8; 0.06666666666666667 +1376577369; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376577669; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1376577970; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376578270; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.26666666666666666; 0.0 +1376578570; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117438.4; 0.0; 0.6; 0.0; 0.0 +1376578870; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.8; 0.0; 0.0 +1376579170; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 124429.86666666667; 0.0; 0.8; 0.0; 0.0 +1376579470; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 155188.0; 0.0; 1.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1376579770; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.06666666666666667; 0.0 +1376580070; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 125827.2; 0.0; 0.6; 0.0; 0.0 +1376580370; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376580670; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 141206.66666666666; 0.0; 0.6; 0.0; 0.0 +1376580970; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 86680.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376581270; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 141206.66666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376581570; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 155188.0; 0.0; 7.4; 0.3333333333333333; 0.13333333333333333 +1376581870; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 144002.93333333332; 0.0; 0.6666666666666666; 0.0; 0.0 +1376582170; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1376582470; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376582770; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376583070; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 192936.0; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1376583370; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376583670; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376583970; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 79689.6; 0.0; 0.8; 0.0; 0.0 +1376584270; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376584570; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376584870; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 89476.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376585170; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 0.6; 0.0; 0.0 +1376585470; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 86680.26666666666; 0.0; 0.6666666666666666; 2.8; 0.0 +1376585770; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376586070; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.0; 0.6; 0.13333333333333333; 0.0 +1376586370; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 142604.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376586670; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 176159.2; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376586970; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376587270; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1376587571; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.06666666666666667; 6.933333333333334; 0.2; 0.13333333333333333 +1376587871; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376588171; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376588471; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 145401.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376588771; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376589071; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.0; 0.0 +1376589371; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376589670; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376589970; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1376590270; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 150993.6; 0.2; 2.0; 0.06666666666666667; 0.4666666666666667 +1376590570; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376590870; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 95069.06666666667; 0.0; 0.6; 0.06666666666666667; 0.0 +1376591170; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 82485.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376591470; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376591771; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 71300.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376592071; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 74097.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376592371; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 62912.0; 0.0; 0.5333333333333333; 0.13333333333333333; 0.0 +1376592671; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376592971; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1376593271; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1376593571; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.6; 0.0; 0.0 +1376593871; 1; 2599.999304; 20.799994432; 0.8; 2097152.0; 170565.86666666667; 0.0; 8.2; 0.26666666666666666; 0.6666666666666666 +1376594171; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376594471; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 79689.6; 0.0; 0.6; 0.0; 0.0 +1376594771; 1; 2599.999304; 65.86664903466666; 2.533333333333333; 2097152.0; 329950.13333333336; 161.73333333333332; 22.933333333333334; 0.0; 0.2 +1376595071; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 486536.8; 0.0; 1.2; 0.06666666666666667; 0.0 +1376595371; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 174760.8; 31.8; 3.6666666666666665; 0.0; 0.0 +1376595671; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 135614.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376595971; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376596271; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 121633.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376596571; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 110448.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376596871; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 97865.33333333333; 0.0; 1.2; 0.0; 0.0 +1376597171; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1376597471; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 190138.66666666666; 0.0; 2.066666666666667; 0.06666666666666667; 0.5333333333333333 +1376597771; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376598071; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1376598371; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 81087.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376598671; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376598971; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376599271; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376599571; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 159381.6; 12.733333333333333; 13.0; 0.4; 0.13333333333333333 +1376599871; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376600171; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1376600471; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376600771; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376601072; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 156586.13333333333; 0.06666666666666667; 2.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1376601372; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 132818.66666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376601672; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1376601972; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 145401.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376602272; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1376602572; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1376602872; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.06666666666666667; 0.0 +1376603172; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 85282.13333333333; 0.0; 0.6; 0.0; 0.0 +1376603472; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376603772; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.0; 0.0 +1376604072; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 75495.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1376604372; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 106254.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376604672; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 220897.6; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1376604972; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 128624.26666666666; 0.0; 7.266666666666667; 0.3333333333333333; 0.13333333333333333 +1376605272; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376605572; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376605872; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 97865.33333333333; 2.6666666666666665; 1.2666666666666666; 0.06666666666666667; 0.13333333333333333 +1376606172; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 1.2; 0.0; 0.0 +1376606472; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376606772; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.06666666666666667; 0.0 +1376607072; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376607372; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376607672; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376607972; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.2; 0.0; 0.0 +1376608272; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 145401.06666666668; 0.0; 2.2666666666666666; 0.13333333333333333; 0.4666666666666667 +1376608572; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376608872; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376609172; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376609472; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376609772; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 62912.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376610072; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1376610372; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376610672; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1376610972; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 135614.93333333332; 0.0; 0.6666666666666666; 0.0; 0.0 +1376611272; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1376611572; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376611872; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 201324.53333333333; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376612172; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.2; 0.0; 0.0 +1376612472; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376612772; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376613072; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 92272.8; 0.6; 1.2; 0.0; 0.0 +1376613372; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.8; 0.0; 0.0 +1376613672; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1376613972; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 125827.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376614272; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 142605.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1376614572; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 90874.66666666667; 0.0; 0.6; 0.0; 0.0 +1376614872; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376615172; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 83884.0; 0.0; 0.6; 0.0; 0.0 +1376615472; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 170565.86666666667; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376615772; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 107652.26666666666; 0.0; 11.733333333333333; 0.06666666666666667; 0.0 +1376616072; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1376616372; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376616672; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376616973; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376617273; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376617573; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376617873; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 124429.86666666667; 0.0; 6.8; 0.26666666666666666; 0.13333333333333333 +1376618173; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1376618473; 1; 2599.999304; 71.06664764266665; 2.733333333333333; 2097152.0; 571821.6; 166.6; 21.533333333333335; 0.06666666666666667; 0.4 +1376618773; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 569025.0666666667; 0.0; 2.466666666666667; 0.0; 0.0 +1376619073; 1; 2599.999304; 24.266660170666665; 0.9333333333333332; 2097152.0; 293599.4666666667; 31.866666666666667; 5.466666666666667; 0.06666666666666667; 0.5333333333333333 +1376619373; 1; 2599.999304; 20.799994432; 0.8; 2097152.0; 197130.93333333332; 0.0; 2.2666666666666666; 0.0; 0.0 +1376619673; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 139808.8; 0.0; 1.5333333333333334; 0.0; 0.0 +1376619973; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376620273; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 125828.0; 0.0; 4.333333333333333; 0.0; 0.0 +1376620573; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376620873; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1376621173; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 132818.4; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376621473; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 109049.86666666667; 0.0; 0.6; 0.0; 0.0 +1376621773; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 135614.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376622073; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 0.6; 0.0; 0.0 +1376622373; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376622673; 1; 2599.999304; 20.799994432; 0.8; 2097152.0; 146798.93333333332; 0.2; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1376622973; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 123030.93333333333; 0.0; 0.8; 0.0; 0.0 +1376623273; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 0.6; 0.0; 0.0 +1376623573; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1376623873; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 100661.6; 0.06666666666666667; 6.933333333333334; 0.2; 0.13333333333333333 +1376624173; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 0.6; 0.0; 0.0 +1376624473; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376624773; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376625073; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1376625373; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376625673; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 113244.8; 1.4666666666666666; 1.0; 0.06666666666666667; 0.06666666666666667 +1376625973; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376626273; 1; 2599.999304; 22.533327301333333; 0.8666666666666667; 2097152.0; 104856.0; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1376626573; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376626873; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376627173; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376627473; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376627773; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 132818.66666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1376628073; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1376628373; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1376628673; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 142605.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376628973; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 150993.6; 0.0; 0.6; 0.0; 0.0 +1376629273; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 132818.66666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1376629573; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376629873; 1; 2599.999304; 22.533327301333333; 0.8666666666666667; 2097152.0; 139808.8; 0.0; 8.2; 0.26666666666666666; 0.6 +1376630173; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 152391.46666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376630474; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1376630774; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 0.8; 0.0; 0.0 +1376631074; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1376631374; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376631674; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376631974; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376632274; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 99263.46666666666; 0.0; 0.6; 0.0; 0.0 +1376632574; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.6; 0.06666666666666667; 0.0 +1376632874; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376633174; 1; 2599.999304; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.6; 0.06666666666666667; 0.0 +1376633474; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 173362.93333333332; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376633774; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376634074; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376634374; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376634674; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 125827.2; 0.0; 1.0666666666666667; 0.06666666666666667; 0.06666666666666667 +1376634974; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 96467.2; 0.0; 2.066666666666667; 0.0; 0.0 +1376635274; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 106254.13333333333; 0.0; 1.6666666666666667; 0.0; 0.0 +1376635574; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1376635874; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376636174; 1; 2599.999304; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376636474; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376636774; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376637074; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 157983.46666666667; 0.6; 8.666666666666666; 0.3333333333333333; 0.6666666666666666 +1376637374; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376637674; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376637974; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376638274; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376638574; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1376638874; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376639174; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1376639474; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1376639774; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376640074; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376640374; 1; 2599.999304; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376640674; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1376640974; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.0; 0.0 +1376641275; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 146799.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376641575; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1376641875; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376642175; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376642475; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 1.2; 0.0; 0.0 +1376642775; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1376643075; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1376643375; 1; 2599.999304; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376643675; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 7.0; 0.26666666666666666; 0.13333333333333333 +1376643975; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1376644275; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 155187.2; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376644575; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1376644875; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376645175; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376645475; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 2.2666666666666666; 0.0 +1376645775; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376646075; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1376646375; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376646675; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376646975; 1; 2599.999304; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6; 0.0; 0.0 +1376647275; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376647575; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376647875; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 209713.6; 0.0; 2.2; 0.0; 0.4666666666666667 +1376648175; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 130021.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376648475; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376648775; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1376649075; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 113244.8; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1376649375; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 134216.0; 0.0; 1.0; 0.0; 0.0 +1376649675; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376649975; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 155188.0; 0.0; 0.8; 0.0; 0.0 +1376650276; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 138410.4; 0.0; 0.8; 0.0; 0.0 +1376650576; 1; 2599.999304; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376650876; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 74097.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376651176; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376651476; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 170566.66666666666; 0.0; 2.2; 0.0; 0.4666666666666667 +1376651776; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 113244.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1376652076; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 2.933333333333333; 0.0 +1376652376; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1376652676; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376652976; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 120235.46666666666; 0.0; 0.6; 4.933333333333334; 0.0 +1376653276; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376653576; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 121632.8; 0.0; 1.2; 0.0; 0.0 +1376653876; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376654176; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.9333333333333333; 0.6666666666666666; 0.0 +1376654476; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376654776; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376655076; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 157983.46666666667; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1376655376; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 128624.0; 0.0; 0.8; 0.06666666666666667; 0.0 +1376655676; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 62912.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1376655976; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 86680.26666666666; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1376656276; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376656576; 1; 2599.999304; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376656876; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376657176; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 1.3333333333333333; 0.0 +1376657476; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8; 1.5333333333333334; 0.0 +1376657776; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.3333333333333333; 0.0 +1376658076; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.6; 0.0 +1376658376; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.7333333333333333; 0.0 +1376658676; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 188741.6; 0.06666666666666667; 2.4; 0.4; 0.5333333333333333 +1376658976; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 139809.06666666668; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1376659276; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 125828.0; 0.0; 11.533333333333333; 0.0; 0.0 +1376659576; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376659876; 1; 2599.999304; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1376660176; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1376660476; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376660776; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376661076; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 142604.53333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376661376; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1376661676; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.6; 0.13333333333333333; 0.0 +1376661976; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1376662276; 1; 2599.999304; 24.266660170666665; 0.9333333333333332; 2097152.0; 198528.53333333333; 12.733333333333333; 14.733333333333333; 0.4; 0.6 +1376662576; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 169169.06666666668; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376662876; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376663176; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 57319.46666666667; 0.0; 1.2; 0.06666666666666667; 0.0 +1376663476; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 62912.0; 0.0; 0.8; 0.2; 0.13333333333333333 +1376663777; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 75495.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376664077; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376664377; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 121632.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1376664677; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 116041.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376664977; 1; 2599.999304; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.6; 0.06666666666666667; 0.0 +1376665277; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 76893.33333333333; 0.0; 0.6; 0.13333333333333333; 0.0 +1376665577; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 0.6; 0.06666666666666667; 0.0 +1376665877; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 171964.0; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1376666177; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376666477; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 72698.93333333333; 0.0; 0.8; 0.0; 0.0 +1376666777; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 75495.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376667077; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1376667377; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1376667677; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 1.0; 0.0; 0.0 +1376667977; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 125827.2; 0.0; 1.7333333333333334; 0.0; 0.0 +1376668277; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 1.0; 0.0; 0.0 +1376668577; 1; 2599.999304; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.5333333333333333; 0.06666666666666667; 0.0 +1376668877; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376669177; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 118837.33333333333; 0.0; 7.2; 0.2; 0.13333333333333333 +1376669477; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 169168.53333333333; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376669777; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 131420.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376670077; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376670377; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376670677; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.6; 0.0; 0.0 +1376670977; 1; 2599.999304; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1376671277; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376671577; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376671878; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376672178; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.6; 0.0; 0.0 +1376672478; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 146799.2; 0.0; 0.6; 0.0; 0.0 +1376672778; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376673078; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 195732.26666666666; 0.06666666666666667; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376673378; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1376673678; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 95069.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376673978; 1; 2599.999304; 0.0; 0.0; 2097152.0; 67106.4; 0.0; 0.5333333333333333; 0.06666666666666667; 0.0 +1376674278; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 76893.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376674578; 1; 2599.999304; 25.99999304; 1.0; 2097152.0; 155188.26666666666; 161.06666666666666; 27.466666666666665; 0.4; 0.5333333333333333 +1376674878; 1; 2599.999304; 48.53332034133333; 1.8666666666666665; 2097152.0; 722816.5333333333; 0.0; 2.6; 0.0; 0.0 +1376675178; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 324357.86666666664; 31.8; 3.0; 0.06666666666666667; 0.0 +1376675478; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 174760.8; 0.0; 2.4; 0.0; 0.0 +1376675778; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 187343.73333333334; 0.0; 1.7333333333333334; 0.0; 0.0 +1376676078; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130022.13333333333; 0.0; 0.5333333333333333; 0.06666666666666667; 0.0 +1376676378; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.5333333333333333; 0.0; 0.0 +1376676678; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 156585.33333333334; 0.0; 2.0; 0.13333333333333333; 0.4666666666666667 +1376676978; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 131420.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376677278; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1376677578; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1376677878; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 83884.0; 0.0; 0.6; 0.13333333333333333; 0.0 +1376678178; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 137013.06666666668; 0.0; 0.8; 0.06666666666666667; 0.0 +1376678478; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376678778; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376679078; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 142605.6; 0.0; 0.6; 0.0; 0.0 +1376679378; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.8; 0.06666666666666667; 0.0 +1376679679; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 96467.2; 0.0; 0.5333333333333333; 0.13333333333333333; 0.0 +1376679979; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376680279; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 183149.86666666667; 0.0; 1.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1376680579; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 142605.6; 0.0; 7.133333333333334; 0.26666666666666666; 0.13333333333333333 +1376680879; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 164973.33333333334; 0.0; 0.6; 0.0; 0.0 +1376681179; 1; 2599.999304; 43.333321733333335; 1.6666666666666665; 2097152.0; 267036.26666666666; 161.0; 14.466666666666667; 0.0; 0.2 +1376681479; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 459973.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1376681779; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 187344.0; 31.8; 3.466666666666667; 0.0; 0.0 +1376682079; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376682379; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376682679; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 116041.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376682979; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 144003.73333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376683279; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376683579; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121632.8; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1376683879; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 150994.4; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1376684179; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 116041.06666666667; 0.06666666666666667; 1.6666666666666667; 0.0; 0.0 +1376684479; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376684779; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1376685079; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1376685379; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 149595.73333333334; 0.0; 1.0; 0.0; 0.0 +1376685679; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 102059.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376685979; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376686279; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376686579; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 0.6; 0.0; 0.0 +1376686879; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1376687179; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 145401.33333333334; 0.0; 6.666666666666667; 0.2; 0.13333333333333333 +1376687479; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 192935.73333333334; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1376687779; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376688079; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376688379; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1376688679; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376688979; 1; 2599.999304; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376689279; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.8; 0.0; 0.0 +1376689579; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 65708.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376689879; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 69902.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376690179; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 62912.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1376690479; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376690779; 1; 2599.999304; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376691079; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 187342.93333333332; 0.06666666666666667; 2.6; 0.06666666666666667; 0.5333333333333333 +1376691379; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 137012.8; 0.0; 0.8; 0.0; 0.0 +1376691679; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376691979; 1; 2599.999304; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376692279; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.13333333333333333; 0.13333333333333333 +1376692579; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 156586.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1376692879; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 131420.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376693179; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 137012.26666666666; 0.06666666666666667; 7.466666666666667; 0.2; 0.13333333333333333 +1376693480; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376693780; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376694080; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.2; 0.06666666666666667 +1376694380; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1376694680; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376694980; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376695280; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376695580; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1376695880; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376696180; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376696480; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 174760.8; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376696780; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 146800.0; 0.0; 1.0; 0.0; 0.0 +1376697080; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.6; 0.0; 0.0 +1376697380; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 0.8; 0.06666666666666667; 0.0 +1376697680; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376697980; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376698280; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 139808.53333333333; 0.06666666666666667; 2.0; 0.06666666666666667; 0.5333333333333333 +1376698580; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 145401.06666666668; 0.0; 0.5333333333333333; 0.0; 0.0 +1376698880; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 120235.46666666666; 0.0; 0.6; 0.0; 0.0 +1376699180; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 124429.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376699480; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1376699780; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 138411.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376700080; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 99263.46666666666; 0.06666666666666667; 6.8; 0.2; 0.13333333333333333 +1376700380; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376700680; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376700980; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376701280; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 86680.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376701581; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1376701881; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 198529.06666666668; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376702181; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376702481; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376702781; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376703081; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 171964.53333333333; 0.0; 11.666666666666666; 0.0; 0.0 +1376703381; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 135614.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376703681; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376703981; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376704281; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376704581; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376704881; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 1.2; 0.0; 0.0 +1376705181; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376705481; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 146799.2; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1376705781; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 145401.06666666668; 0.0; 6.733333333333333; 0.26666666666666666; 0.13333333333333333 +1376706081; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1376706381; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376706681; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 0.6; 0.0; 0.0 +1376706981; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1376707281; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 69902.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376707581; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.4; 0.0 +1376707881; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 124429.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376708181; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376708481; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376708781; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376709081; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 159383.2; 0.06666666666666667; 2.2666666666666666; 1.0666666666666667; 0.5333333333333333 +1376709381; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 125827.2; 0.0; 0.6; 0.0; 0.0 +1376709681; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 72698.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376709981; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376710281; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1376710581; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.5333333333333333; 0.06666666666666667; 0.0 +1376710881; 1; 2599.999304; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1376711181; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1376711481; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376711781; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376712082; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 86680.26666666666; 0.0; 6.933333333333334; 0.26666666666666666; 0.2 +1376712382; 1; 2599.999304; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.6; 0.06666666666666667; 0.0 +1376712682; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 134216.0; 0.0; 2.0; 0.06666666666666667; 0.4666666666666667 +1376712982; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1376713282; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376713582; 1; 2599.999304; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376713882; 1; 2599.999304; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.6; 0.0; 0.0 +1376714182; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 69902.66666666667; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1376714482; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.0; 0.0 +1376714782; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376715082; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 106254.13333333333; 0.0; 0.6; 0.0; 0.0 +1376715382; 1; 2599.999304; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.5333333333333333; 0.06666666666666667; 0.0 +1376715682; 1; 2599.999304; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.8; 0.0; 0.0 +1376715982; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 75495.2; 0.0; 1.0; 0.0; 0.0 +1376716282; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 150993.06666666668; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376716582; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 131420.53333333333; 0.0; 0.5333333333333333; 0.0; 0.0 +1376716882; 1; 2599.999304; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376717182; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376717482; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 0.6; 0.0; 0.0 +1376717782; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.5333333333333333; 0.0; 0.0 +1376718082; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376718382; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 190138.93333333332; 0.0; 6.733333333333333; 0.26666666666666666; 0.13333333333333333 +1376718682; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 1.0; 0.06666666666666667; 0.0 +1376718982; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 86680.26666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1376719282; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117437.6; 0.0; 0.5333333333333333; 0.0; 0.0 +1376719582; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1376719882; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 187343.2; 0.2; 2.466666666666667; 0.0; 0.5333333333333333 +1376720182; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1376720482; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376720782; 1; 2599.999304; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376721082; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376721382; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 123031.73333333334; 0.06666666666666667; 2.2666666666666666; 0.26666666666666666; 0.13333333333333333 +1376721682; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 142604.8; 0.0; 1.4666666666666666; 0.13333333333333333; 0.0 +1376721982; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 0.6; 0.0; 0.0 +1376722282; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 127225.33333333333; 0.0; 0.6; 0.0; 0.0 +1376722582; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 92272.8; 0.0; 0.8; 3.7333333333333334; 0.0 +1376722882; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376723182; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376723482; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 173362.13333333333; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1376723782; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 134216.8; 12.733333333333333; 17.0; 0.3333333333333333; 0.2 +1376724082; 1; 2599.999304; 60.66665042666666; 2.3333333333333335; 2097152.0; 279618.6666666667; 161.0; 22.133333333333333; 0.06666666666666667; 0.4 +1376724382; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 763362.4; 0.0; 2.7333333333333334; 0.06666666666666667; 0.0 +1376724682; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 348124.8; 31.8; 3.533333333333333; 0.0; 0.0 +1376724982; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 188741.6; 0.0; 2.3333333333333335; 0.0; 0.0 +1376725282; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 134216.8; 0.0; 1.8; 0.0; 0.0 +1376725582; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 1.7333333333333334; 0.0; 0.0 +1376725882; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376726182; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1376726482; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376726782; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 130021.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376727082; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 181750.93333333332; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1376727382; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 1.6666666666666667; 0.06666666666666667; 0.0 +1376727682; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 141207.46666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376727982; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376728282; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.2; 0.0 +1376728583; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376728883; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376729183; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376729483; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376729783; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376730083; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 93670.93333333333; 0.0; 7.0; 0.3333333333333333; 0.13333333333333333 +1376730383; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130021.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376730683; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 166372.0; 0.06666666666666667; 2.4; 0.13333333333333333; 0.4666666666666667 +1376730983; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1376731283; 1; 2599.999304; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376731583; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376731883; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376732183; 1; 2599.999304; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376732483; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376732783; 1; 2599.999304; 0.0; 0.0; 2097152.0; 100660.8; 0.0; 1.0; 0.0; 0.0 +1376733083; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376733383; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376733683; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1376733983; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376734283; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 184547.2; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376734583; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376734883; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 64310.13333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376735184; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376735484; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 7.866666666666666; 0.0 +1376735784; 1; 2599.999304; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376736084; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 144002.93333333332; 0.0; 7.533333333333333; 0.2; 0.13333333333333333 +1376736384; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 155188.0; 0.0; 0.8; 0.13333333333333333; 0.0 +1376736684; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.2; 0.06666666666666667; 0.0 +1376736984; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 72698.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376737284; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.2; 0.0 +1376737584; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376737884; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 160779.46666666667; 0.0; 2.466666666666667; 0.2; 0.5333333333333333 +1376738184; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376738484; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 130022.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376738784; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376739084; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 71300.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376739384; 1; 2599.999304; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376739684; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376739984; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376740284; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376740584; 1; 2599.999304; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1376740884; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376741184; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.13333333333333333; 0.0 +1376741484; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 171964.8; 0.0; 2.2; 0.13333333333333333; 0.4666666666666667 +1376741784; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376742084; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1376742384; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 6.866666666666666; 0.3333333333333333; 0.2 +1376742684; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1376742984; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376743284; 1; 2599.999304; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376743584; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376743885; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376744185; 1; 2599.999304; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376744485; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1376744785; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376745085; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 139808.53333333333; 0.06666666666666667; 2.3333333333333335; 0.2; 0.4666666666666667 +1376745385; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1376745685; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 90874.66666666667; 0.0; 0.6; 0.0; 0.0 +1376745985; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 81087.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376746285; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376746585; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 75495.2; 0.0; 11.6; 0.13333333333333333; 0.0 +1376746885; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 78291.46666666666; 0.0; 0.8; 0.0; 0.0 +1376747185; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1376747485; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376747785; 1; 2599.999304; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1376748085; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376748385; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 116041.06666666667; 0.0; 7.0; 0.2; 0.13333333333333333 +1376748685; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 167769.86666666667; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1376748985; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 138411.2; 0.06666666666666667; 1.1333333333333333; 0.0; 0.0 +1376749285; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1376749585; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1376749885; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 123031.73333333334; 0.06666666666666667; 1.0666666666666667; 0.06666666666666667; 0.13333333333333333 +1376750185; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 128624.26666666666; 0.06666666666666667; 1.2666666666666666; 0.06666666666666667; 0.13333333333333333 +1376750485; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376750785; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376751085; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.6; 0.06666666666666667; 0.0 +1376751385; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.6; 0.0; 0.0 +1376751685; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376751985; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376752285; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 141207.46666666667; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1376752586; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376752886; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1376753186; 1; 2599.999304; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376753485; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 130022.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376753785; 1; 2599.999304; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376754085; 1; 2599.999304; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376754385; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 79689.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376754685; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 81087.73333333334; 0.0; 7.2; 0.2; 0.13333333333333333 +1376754985; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 139808.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376755285; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376755585; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376755885; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 155188.26666666666; 0.06666666666666667; 2.466666666666667; 0.0; 0.4666666666666667 +1376756185; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 124429.6; 0.0; 0.8; 0.0; 0.0 +1376756485; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 125826.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376756785; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95068.8; 0.0; 0.5333333333333333; 0.0; 0.0 +1376757085; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.0; 1.4; 0.0; 0.0 +1376757385; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376757685; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376757985; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376758285; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 155188.8; 0.0; 0.6; 0.0; 0.0 +1376758585; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1376758885; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 65708.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376759186; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 81087.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376759486; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 169168.8; 0.06666666666666667; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1376759786; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 125827.73333333334; 0.0; 1.0; 0.0; 0.0 +1376760086; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 137012.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1376760386; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 117438.66666666667; 0.0; 6.6; 0.2; 0.13333333333333333 +1376760686; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 117438.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376760986; 1; 2599.999304; 20.799994432; 0.8; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376761286; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 125827.2; 0.0; 1.0; 0.0; 0.0 +1376761586; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1376761886; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376762186; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 95069.06666666667; 0.0; 0.6; 0.0; 0.0 +1376762486; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.06666666666666667; 0.06666666666666667 +1376762786; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 135614.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1376763086; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 198528.8; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1376763386; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 125827.73333333334; 0.0; 0.8; 0.0; 0.0 +1376763686; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376763986; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 0.5333333333333333; 0.0; 0.0 +1376764286; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376764586; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376764886; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376765186; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1376765486; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 74097.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376765786; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 89476.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376766086; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376766386; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 139808.53333333333; 0.0; 7.0; 0.26666666666666666; 0.13333333333333333 +1376766686; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 185944.53333333333; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1376766986; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 116041.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376767286; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 138411.2; 0.0; 0.5333333333333333; 0.0; 0.0 +1376767586; 1; 2599.999304; 45.06665460266667; 1.7333333333333334; 2097152.0; 166371.73333333334; 161.2; 14.133333333333333; 0.0; 0.2 +1376767886; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 432010.93333333335; 0.0; 1.2; 0.0; 0.0 +1376768187; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 177556.53333333333; 31.8; 3.4; 0.0; 0.0 +1376768487; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 184546.93333333332; 0.0; 1.0666666666666667; 0.0; 0.0 +1376768787; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1376769087; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376769387; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 142605.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376769687; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1376769987; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376770287; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 155188.0; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1376770587; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376770887; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1376771187; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1376771487; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376771787; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376772087; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1376772387; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 86680.26666666666; 0.0; 1.0; 0.0; 0.0 +1376772687; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1376772987; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 117438.4; 0.0; 7.0; 0.26666666666666666; 0.13333333333333333 +1376773287; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 110448.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376773587; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376773887; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 180352.8; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1376774187; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376774487; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1376774787; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1376775087; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1376775387; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1376775687; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376775988; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376776288; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376776588; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376776891; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376777191; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1376777491; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 149594.4; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376777791; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 127225.33333333333; 0.0; 0.8; 0.0; 0.0 +1376778091; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1376778391; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.6; 0.0; 0.0 +1376778691; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 1.3333333333333333; 0.06666666666666667; 0.13333333333333333 +1376778991; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 114642.93333333333; 0.06666666666666667; 0.9333333333333333; 0.0; 0.0 +1376779291; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376779591; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376779891; 1; 2599.999304; 46.799987472000005; 1.8; 2097152.0; 153789.6; 161.46666666666667; 27.933333333333334; 0.3333333333333333; 0.6 +1376780191; 1; 2599.999304; 34.66665738666667; 1.3333333333333335; 2097152.0; 735398.9333333333; 0.0; 2.4; 0.0; 0.0 +1376780491; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 290802.93333333335; 31.8; 3.3333333333333335; 0.0; 0.0 +1376780791; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 178954.4; 0.0; 2.3333333333333335; 0.0; 0.0 +1376781091; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 184547.73333333334; 0.06666666666666667; 3.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1376781391; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376781691; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376781991; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.0; 0.0 +1376782291; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 121633.6; 0.06666666666666667; 1.0666666666666667; 0.0; 0.0 +1376782591; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130021.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376782891; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376783191; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 137012.53333333333; 0.0; 1.2; 0.0; 0.0 +1376783491; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 164973.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376783791; 1; 2599.999304; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376784091; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376784392; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1376784692; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 156586.13333333333; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1376784992; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 1.2; 0.0; 0.0 +1376785292; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121632.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376785592; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376785892; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376786191; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 134216.8; 12.733333333333333; 13.066666666666666; 0.3333333333333333; 0.13333333333333333 +1376786491; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 134216.8; 0.0; 1.3333333333333333; 0.0; 0.0 +1376786791; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376787091; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 120235.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376787391; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1376787691; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 138411.2; 0.0; 1.0; 0.0; 0.0 +1376787991; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 78291.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376788291; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 131419.73333333334; 0.0; 2.2; 0.06666666666666667; 0.5333333333333333 +1376788591; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1376788891; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376789191; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 68504.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376789491; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376789791; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376790092; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376790392; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 127225.6; 0.0; 12.0; 0.0; 0.0 +1376790692; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130022.13333333333; 0.0; 0.5333333333333333; 0.0; 0.0 +1376790992; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 132818.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376791292; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1376791592; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.6; 0.0; 0.0 +1376791892; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 127226.13333333333; 0.0; 2.8; 0.06666666666666667; 0.4666666666666667 +1376792192; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376792492; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 114642.93333333333; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1376792792; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376793092; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1376793392; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376793692; 1; 2599.999304; 19.066661562666667; 0.7333333333333333; 2097152.0; 72698.93333333333; 0.0; 0.8; 0.0; 0.0 +1376793992; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376794292; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376794592; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1376794892; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 81087.73333333334; 0.0; 0.8; 0.0; 0.0 +1376795192; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376795492; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 159380.8; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1376795792; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.0; 0.0 +1376796092; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 78291.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376796392; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1376796692; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 128623.46666666666; 0.0; 0.6; 0.0; 0.0 +1376796992; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 74097.06666666667; 0.0; 0.6; 0.0; 0.0 +1376797292; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376797592; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 145401.86666666667; 0.0; 1.2; 0.0; 0.0 +1376797892; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1376798193; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 81087.73333333334; 0.0; 0.5333333333333333; 0.0; 0.0 +1376798493; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.6; 0.0; 0.0 +1376798793; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 123031.73333333334; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1376799093; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 185945.33333333334; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376799393; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376799693; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.0; 0.0 +1376799993; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 79689.6; 0.0; 0.8; 0.0; 0.0 +1376800293; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376800593; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376800893; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1376801193; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376801493; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 76893.33333333333; 0.0; 1.6; 0.0; 0.0 +1376801793; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 109050.4; 0.0; 0.5333333333333333; 0.0; 0.0 +1376802093; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 144003.73333333334; 0.0; 0.6; 0.0; 0.0 +1376802393; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 138410.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376802693; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 195731.2; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376802993; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376803293; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 135614.93333333332; 0.0; 0.6666666666666666; 0.0; 0.0 +1376803593; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1376803893; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 127226.13333333333; 0.0; 0.6; 0.0; 0.0 +1376804193; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376804493; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 113244.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376804793; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 138411.2; 0.0; 7.0; 0.2; 0.13333333333333333 +1376805093; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 130021.6; 0.0; 0.6; 0.0; 0.0 +1376805393; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1376805693; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376805993; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 0.6; 0.0; 0.0 +1376806293; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 208314.93333333332; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376806593; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 169169.33333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376806893; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 149595.46666666667; 0.0; 0.8; 0.0; 0.0 +1376807193; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 132817.86666666667; 0.0; 0.8; 0.0; 0.0 +1376807493; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.06666666666666667; 0.13333333333333333 +1376807793; 1; 2599.999304; 17.333328693333335; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.8; 0.06666666666666667; 0.0 +1376808093; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 81087.73333333334; 0.0; 1.4666666666666666; 0.06666666666666667; 0.0 +1376808393; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1376808693; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 79689.6; 0.0; 0.5333333333333333; 0.0; 0.0 +1376808993; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376809293; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 123030.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376809593; 1; 2599.999304; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.5333333333333333; 0.0; 0.0 +1376809894; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 191537.86666666667; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1376810194; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376810494; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 131420.53333333333; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1376810794; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 97865.33333333333; 0.0; 0.6; 0.0; 0.0 +1376811094; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376811394; 1; 2599.999304; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.6; 0.0; 0.0 +1376811694; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376811994; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376812294; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.6; 0.0; 0.0 +1376812594; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376812894; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376813194; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.6; 0.0; 0.0 +1376813494; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 191537.86666666667; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376813794; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1376814094; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.6; 0.0; 0.0 +1376814394; 1; 2599.999304; 0.0; 0.0; 2097152.0; 67106.4; 0.0; 0.5333333333333333; 0.0; 0.0 +1376814694; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376814994; 1; 2599.999304; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.6; 0.06666666666666667; 0.0 +1376815294; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 75495.2; 0.0; 1.2; 0.0; 0.0 +1376815594; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.6; 0.0; 0.0 +1376815894; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376816194; 1; 2599.999304; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.8; 0.0; 0.0 +1376816494; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376816794; 1; 2599.999304; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376817094; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 150993.6; 0.2; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1376817394; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1376817694; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376817994; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376818294; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 132817.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376818594; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376818894; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376819194; 1; 2599.999304; 0.0; 0.0; 2097152.0; 57319.46666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376819494; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376819794; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376820094; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 123031.73333333334; 0.0; 1.8; 0.0; 0.0 +1376820394; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376820694; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 150993.6; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1376820994; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376821294; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121632.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376821594; 1; 2599.999304; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376821894; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376822194; 1; 2599.999304; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1376822494; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376822794; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376823094; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 173362.93333333332; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1376823394; 1; 2599.999304; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376823694; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 79689.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376823995; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376824295; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 142604.8; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1376824595; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376824895; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1376825195; 1; 2599.999304; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376825495; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 114642.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376825795; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376826095; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376826395; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 1.4; 0.0; 0.0 +1376826695; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 120234.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376826995; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 134216.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376827295; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376827595; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376827895; 1; 2599.999304; 25.99999304; 1.0; 2097152.0; 185945.6; 161.06666666666666; 22.0; 0.13333333333333333; 0.8666666666666667 +1376828195; 1; 2599.999304; 51.99998608; 2.0; 2097152.0; 812294.1333333333; 0.0; 3.533333333333333; 0.0; 0.0 +1376828495; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 402650.93333333335; 31.8; 3.066666666666667; 0.0; 0.0 +1376828795; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 215304.53333333333; 0.06666666666666667; 2.3333333333333335; 0.0; 0.0 +1376829095; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 138411.2; 0.0; 1.8666666666666667; 0.0; 0.0 +1376829395; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.0; 0.0 +1376829695; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376829995; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 111846.66666666667; 0.0; 6.666666666666667; 0.2; 0.13333333333333333 +1376830295; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376830595; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376830895; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.13333333333333333; 0.06666666666666667 +1376831195; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1376831495; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 163575.73333333334; 0.0; 2.3333333333333335; 0.13333333333333333; 0.5333333333333333 +1376831795; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1376832096; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376832396; 1; 2599.999304; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376832696; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 85282.13333333333; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1376832996; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1376833296; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376833596; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1376833896; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 125828.0; 0.0; 11.4; 0.0; 0.0 +1376834196; 1; 2599.999304; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376834495; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 134215.73333333334; 0.0; 0.8; 0.0; 0.0 +1376834795; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376835095; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 187343.73333333334; 0.0; 2.2; 0.06666666666666667; 0.5333333333333333 +1376835395; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1376835695; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.8; 0.13333333333333333; 0.0 +1376835995; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376836295; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 141206.66666666666; 0.0; 7.066666666666666; 0.26666666666666666; 0.2 +1376836595; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 146800.0; 0.0; 0.8; 0.0; 0.0 +1376836895; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376837195; 1; 2599.999304; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376837495; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376837795; 1; 2599.999304; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376838096; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376838396; 1; 2599.999304; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376838696; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 192935.73333333334; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1376838996; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 146800.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376839296; 1; 2599.999304; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376839596; 1; 2599.999304; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376839896; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1376840196; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376840496; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376840796; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 72698.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376841096; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 81087.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376841396; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376841696; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376841996; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1376842296; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 155188.0; 0.06666666666666667; 8.266666666666667; 0.26666666666666666; 0.6 +1376842596; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 130022.4; 0.06666666666666667; 1.0; 0.06666666666666667; 0.0 +1376842896; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376843196; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376843496; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376843796; 1; 2599.999304; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376844096; 1; 2599.999304; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376844396; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376844696; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 138410.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376844996; 1; 2599.999304; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376845296; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376845596; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1376845896; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 104855.2; 0.06666666666666667; 2.8; 0.06666666666666667; 0.5333333333333333 +1376846196; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 137011.73333333334; 0.0; 0.8; 0.0; 0.0 +1376846496; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 138410.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1376846796; 1; 2599.999304; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376847096; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1376847396; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376847696; 1; 2599.999304; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376847996; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 79689.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376848296; 1; 2599.999304; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376848596; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 121633.6; 12.733333333333333; 13.4; 0.3333333333333333; 0.2 +1376848896; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 159381.6; 0.0; 1.0; 0.0; 0.0 +1376849196; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 167771.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376849496; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 142605.6; 0.0; 1.6666666666666667; 0.06666666666666667; 0.4666666666666667 +1376849796; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 76893.33333333333; 0.0; 0.8; 0.0; 0.0 +1376850096; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1376850396; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1376850696; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376850996; 1; 2599.999304; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376851296; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376851596; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376851896; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376852196; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376852496; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1376852796; 1; 2599.999304; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1376853096; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 184548.0; 0.06666666666666667; 2.2; 0.06666666666666667; 0.4666666666666667 +1376853396; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376853697; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.6; 0.06666666666666667; 0.0 +1376853996; 1; 2599.999304; 36.399990255999995; 1.4; 2097152.0; 171964.8; 161.06666666666666; 14.333333333333334; 0.0; 0.2 +1376854297; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 461372.0; 0.0; 1.3333333333333333; 0.0; 0.0 +1376854597; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 222295.2; 31.8; 9.666666666666666; 0.2; 0.13333333333333333 +1376854897; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 218100.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376855197; 1; 2599.999304; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376855497; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376855797; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 130021.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376856097; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376856397; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376856697; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 167769.6; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1376856997; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 159381.6; 0.0; 1.0; 0.0; 0.0 +1376857297; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376857597; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376857897; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 148197.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376858197; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 124429.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376858497; 1; 2599.999304; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1376858797; 1; 2599.999304; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376859097; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376859397; 1; 2599.999304; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376859697; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1376859997; 1; 2599.999304; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376860297; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 197129.6; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1376860597; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 137012.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376860897; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 132818.66666666666; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1376861197; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 144002.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376861497; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376861797; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 132818.13333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1376862097; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1376862397; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376862697; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376862997; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376863298; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 69902.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376863598; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 69902.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376863898; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 118837.33333333333; 0.06666666666666667; 2.2; 0.06666666666666667; 0.4666666666666667 +1376864198; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1376864498; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376864798; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376865098; 1; 2599.999304; 9.2857118; 0.35714285714285715; 2097152.0; 140808.0; 0.07142857142857142; 1.4285714285714286; 0.14285714285714285; 0.14285714285714285 +1376865398; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1376865698; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376865998; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376866298; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 110448.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376866599; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1376866899; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 107652.26666666666; 0.2; 0.9333333333333333; 0.0; 0.0 +1376867199; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 128623.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376867500; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 174761.06666666668; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1376867801; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1376868101; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1376868401; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376868701; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.6; 0.0; 0.0 +1376869001; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 75495.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376869301; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376869601; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376869901; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.6; 0.0; 0.0 +1376870201; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1376870501; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376870801; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 162178.66666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376871101; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 167770.4; 0.0; 2.8; 0.06666666666666667; 0.5333333333333333 +1376871401; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376871701; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 109049.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376872001; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1376872301; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 90874.66666666667; 0.06666666666666667; 1.4; 0.0; 0.0 +1376872601; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376872901; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376873201; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1376873501; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1376873801; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 0.5333333333333333; 0.0; 0.0 +1376874101; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376874401; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376874701; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 181751.2; 0.2; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1376875001; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 127225.86666666667; 0.0; 1.0; 0.0; 0.0 +1376875301; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376875601; 1; 2599.999304; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376875901; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1376876201; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1376876501; 1; 2599.999304; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376876801; 1; 2599.999304; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376877101; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376877401; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 125827.2; 0.0; 11.6; 0.0; 0.0 +1376877701; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376878001; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 145401.06666666668; 0.0; 0.8; 0.0; 0.0 +1376878302; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 171965.06666666668; 0.06666666666666667; 1.9333333333333333; 0.06666666666666667; 0.4666666666666667 +1376878602; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 138410.93333333332; 0.0; 0.8; 0.0; 0.0 +1376878902; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376879202; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1376879502; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376879802; 1; 2599.999304; 71.06664764266665; 2.733333333333333; 2097152.0; 661299.7333333333; 161.0; 21.466666666666665; 0.06666666666666667; 0.4 +1376880102; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 416631.73333333334; 0.0; 8.733333333333333; 0.2; 0.13333333333333333 +1376880402; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 262841.06666666665; 31.8; 3.7333333333333334; 0.0; 0.0 +1376880702; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 163576.53333333333; 0.0; 2.2666666666666666; 0.0; 0.0 +1376881002; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 96467.2; 0.0; 1.4; 0.0; 0.0 +1376881302; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 113244.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376881602; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 128623.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376881902; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 206917.33333333334; 0.0; 1.9333333333333333; 0.06666666666666667; 0.4666666666666667 +1376882202; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 131419.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376882502; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 96466.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376882802; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 83883.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376883102; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376883402; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1376883702; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1376884002; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.0; 0.0 +1376884302; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376884602; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376884902; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 81087.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376885202; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 69902.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376885502; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 232082.93333333332; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1376885802; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 128624.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376886102; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376886402; 1; 2599.999304; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376886702; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.06666666666666667; 6.8; 0.26666666666666666; 0.2 +1376887002; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 155186.93333333332; 0.0; 0.7333333333333333; 0.0; 0.0 +1376887302; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 120235.2; 0.0; 1.0; 0.0; 0.0 +1376887602; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1376887902; 1; 2599.999304; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376888202; 1; 2599.999304; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376888502; 1; 2599.999304; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376888802; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1376889102; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 180352.53333333333; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376889403; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376889703; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.8; 0.0; 0.0 +1376890003; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 124429.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376890303; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 81087.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376890603; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 1.4666666666666666; 0.0; 0.0 +1376890903; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1376891203; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376891503; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1376891803; 1; 2599.999304; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1376892103; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376892403; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 145401.06666666668; 0.0; 6.533333333333333; 0.2; 0.13333333333333333 +1376892703; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 176158.13333333333; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1376893003; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376893303; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.6; 0.0; 0.0 +1376893603; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1376893903; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.06666666666666667; 0.06666666666666667 +1376894203; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 120235.46666666666; 0.0; 2.0; 0.06666666666666667; 0.0 +1376894503; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 144003.73333333334; 0.0; 1.4; 0.0; 0.0 +1376894803; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.5333333333333333; 0.0; 0.0 +1376895103; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 81087.73333333334; 0.0; 0.6; 0.0; 0.0 +1376895403; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376895703; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.2; 0.0; 0.0 +1376896003; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1376896304; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 128623.46666666666; 0.0; 2.0; 0.06666666666666667; 0.4666666666666667 +1376896604; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 88078.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376896904; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376897204; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.5333333333333333; 0.0; 0.0 +1376897504; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.0; 0.6; 0.0; 0.0 +1376897804; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 81087.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376898104; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376898404; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 156586.13333333333; 0.0; 1.4666666666666666; 0.06666666666666667; 0.0 +1376898704; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376899004; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1376899304; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 7.333333333333333; 0.26666666666666666; 0.13333333333333333 +1376899604; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376899904; 1; 2599.999304; 15.599995824; 0.6; 2097152.0; 167771.46666666667; 0.6; 2.2; 0.06666666666666667; 0.5333333333333333 +1376900204; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 135614.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1376900504; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 71300.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1376900804; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1376901104; 1; 2599.999304; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.8; 0.0; 0.0 +1376901404; 1; 2599.999304; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376901704; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1376902004; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.5333333333333333; 0.06666666666666667; 0.0 +1376902304; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1376902604; 1; 2599.999304; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376902904; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.6; 0.0; 0.0 +1376903204; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 132818.4; 0.0; 0.6; 0.0; 0.0 +1376903504; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 218101.06666666668; 0.0; 1.9333333333333333; 0.06666666666666667; 0.5333333333333333 +1376903804; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376904104; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1376904404; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1376904704; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 127225.86666666667; 0.0; 6.733333333333333; 0.4; 0.06666666666666667 +1376905004; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 142605.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1376905304; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 99263.46666666666; 0.0; 1.2; 0.0; 0.0 +1376905604; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376905904; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 132818.4; 0.0; 0.8; 0.0; 0.0 +1376906204; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 117438.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376906504; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 62912.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376906804; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.0; 0.0 +1376907104; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 184548.0; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1376907404; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.0; 0.0 +1376907704; 1; 2599.999304; 1.7333328693333334; 0.06666666666666667; 2097152.0; 132818.66666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1376908004; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1376908304; 1; 2599.999304; 3.466665738666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376908604; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.26666666666666666; 0.0 +1376908904; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.4; 0.0 +1376909204; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 131420.53333333333; 0.0; 1.0; 0.0; 0.0 +1376909504; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.0666666666666667; 2.4; 0.0 +1376909804; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376910104; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.13333333333333333; 0.0 +1376910404; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 121632.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376910705; 1; 2599.999304; 22.533327301333333; 0.8666666666666667; 2097152.0; 170566.66666666666; 12.8; 16.466666666666665; 0.4666666666666667; 0.7333333333333333 +1376911005; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 106254.13333333333; 0.0; 1.2; 0.0; 0.0 +1376911305; 1; 2599.999304; 10.399997216; 0.4; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376911605; 1; 2599.999304; 5.199998608; 0.2; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376911905; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 162178.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376912205; 1; 2599.999304; 8.666664346666668; 0.33333333333333337; 2097152.0; 148197.33333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1376912505; 1; 2599.999304; 6.933331477333334; 0.26666666666666666; 2097152.0; 96466.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376912805; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 1.2; 0.0; 0.0 +1376913105; 1; 2599.999304; 13.866662954666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376913405; 1; 2599.999304; 12.133330085333332; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.0; 0.0 +1376913705; 1; 2599.9993; 28.888881111111115; 1.1111111111111112; 2097152.0; 125828.0; 0.0; 1.125; 0.0; 0.0 +1376914005; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376914305; 1; 2599.9993; 13.866662933333332; 0.5333333333333333; 2097152.0; 166372.26666666666; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1376914605; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376914905; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1376915205; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 61513.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376915505; 1; 2599.999343; 28.599992773000004; 1.1; 2097152.0; 77592.4; 0.0; 1.0; 0.1111111111111111; 0.0 +1376915805; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376916105; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 146800.0; 0.0; 6.8; 0.3333333333333333; 0.13333333333333333 +1376916405; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376916705; 1; 2599.999343; 5.199998686; 0.2; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1376917005; 1; 2599.999343; 5.199998686; 0.2; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376917305; 1; 2599.999343; 3.4666657906666667; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376917605; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 124429.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376917905; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 199925.33333333334; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376918205; 1; 2599.999343; 3.4666657906666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376918505; 1; 2599.999343; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376918805; 1; 2599.999343; 5.199998686; 0.2; 2097152.0; 106254.13333333333; 0.0; 0.6; 0.0; 0.0 +1376919105; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1376919405; 1; 2599.999343; 3.4666657906666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1376919705; 1; 2599.999343; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1376920005; 1; 2599.999343; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1376920306; 1; 2599.999343; 3.4666657906666667; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1376920606; 1; 2599.99945; 25.9999945; 1.0; 2097152.0; 76257.81818181818; 0.0; 1.1; 0.0; 0.0 +1376920906; 1; 2599.99945; 8.666664833333334; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376921206; 1; 2599.99945; 12.133330766666665; 0.4666666666666666; 2097152.0; 83884.0; 0.0; 11.6; 0.0; 0.0 +1376921506; 1; 2599.99945; 12.133330766666665; 0.4666666666666666; 2097152.0; 156584.8; 0.0; 2.2; 0.0; 0.4666666666666667 +1376921806; 1; 2599.99945; 10.3999978; 0.4; 2097152.0; 130022.13333333333; 0.0; 7.2; 0.4; 0.2 +1376922106; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 159382.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1376922406; 1; 2599.99945; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1376922706; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 86680.26666666666; 0.0; 1.1333333333333333; 0.06666666666666667; 0.13333333333333333 +1376923006; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 121633.06666666667; 0.0; 1.0; 0.0; 0.0 +1376923306; 1; 2599.99945; 5.1999989; 0.2; 2097152.0; 110448.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376923606; 1; 2599.99945; 1.7333329666666666; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376923906; 1; 2599.999306; 21.272721594545455; 0.8181818181818181; 2097152.0; 114388.72727272728; 0.0; 1.0; 0.0; 0.0 +1376924206; 1; 2599.999306; 3.4666657413333337; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1376924506; 1; 2599.999297; 28.88888107777778; 1.1111111111111112; 2097152.0; 88544.44444444444; 0.0; 0.75; 0.0; 0.0 +1376924806; 1; 2599.999334; 28.363629098181818; 1.0909090909090908; 2097152.0; 101042.90909090909; 0.0; 0.8; 0.1; 0.0 +1376925106; 1; 2599.999334; 20.799994672000004; 0.8; 2097152.0; 141206.66666666666; 0.0; 2.2; 1.0; 0.5333333333333333 +1376925406; 1; 2599.999334; 17.333328893333338; 0.6666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.6666666666666666; 2.066666666666667; 0.0 +1376925706; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 88078.4; 0.0; 0.6; 0.06666666666666667; 0.0 +1376926006; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1376926306; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.6; 0.06666666666666667; 0.0 +1376926606; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 61513.86666666667; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376926906; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.13333333333333333; 0.0 +1376927206; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 102059.73333333334; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1376927506; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 104856.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1376927806; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1376928106; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 71300.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1376928406; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 86680.26666666666; 0.0; 6.733333333333333; 0.2; 0.13333333333333333 +1376928706; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 155188.0; 0.0; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1376929006; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 145401.86666666667; 0.0; 0.8; 0.0; 0.0 +1376929306; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376929606; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1376929906; 1; 2599.999334; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376930207; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376930507; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 75495.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376930807; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 134216.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376931107; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.4; 0.0; 0.6; 0.0; 0.0 +1376931407; 1; 2599.999334; 57.19998534800001; 2.2; 2097152.0; 268433.3333333333; 161.0; 21.733333333333334; 0.0; 0.4 +1376931707; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 773148.0; 0.0; 2.6; 0.0; 0.0 +1376932007; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 304784.0; 31.8; 3.2666666666666666; 0.0; 0.0 +1376932307; 1; 2599.999334; 17.333328893333338; 0.6666666666666667; 2097152.0; 219498.93333333332; 0.0; 3.6; 0.0; 0.4666666666666667 +1376932607; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 124429.6; 0.0; 1.4666666666666666; 0.0; 0.0 +1376932907; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376933207; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.6; 0.0; 0.0 +1376933507; 1; 2599.999334; 0.0; 0.0; 2097152.0; 145400.53333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376933807; 1; 2599.999334; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 0.8; 0.0; 0.0 +1376934107; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1376934407; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 146799.46666666667; 0.0; 7.333333333333333; 0.2; 0.13333333333333333 +1376934707; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 138410.93333333332; 0.0; 0.7333333333333333; 0.0; 0.0 +1376935007; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.4666666666666666; 0.0; 0.0 +1376935307; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1376935607; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1376935907; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 138410.4; 0.06666666666666667; 2.3333333333333335; 0.0; 0.4666666666666667 +1376936207; 1; 2599.999334; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1376936507; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376936807; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376937107; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376937407; 1; 2599.999334; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1376937707; 1; 2599.999334; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376938007; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1376938307; 1; 2599.999334; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1376938607; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 121632.8; 0.0; 0.6; 0.06666666666666667; 0.0 +1376938907; 1; 2599.999334; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.6; 0.0; 0.0 +1376939208; 1; 2599.999334; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376939508; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 139809.33333333334; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1376939808; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.06666666666666667; 1.1333333333333333; 0.0; 0.0 +1376940108; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.5333333333333333; 0.0; 0.0 +1376940408; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 111846.13333333333; 161.0; 13.266666666666667; 0.0; 0.2 +1376940708; 1; 2599.999334; 38.13332356533333; 1.4666666666666666; 2097152.0; 518693.6; 0.0; 7.933333333333334; 0.26666666666666666; 0.13333333333333333 +1376941008; 1; 2599.999334; 0.0; 0.0; 2097152.0; 225092.53333333333; 31.8; 3.0; 0.0; 0.0 +1376941308; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 219499.73333333334; 0.0; 1.8; 0.0; 0.0 +1376941608; 1; 2599.999334; 0.0; 0.0; 2097152.0; 116040.8; 0.0; 1.2; 0.0; 0.0 +1376941908; 1; 2599.999334; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376942208; 1; 2599.999334; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376942508; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1376942808; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376943108; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 190139.73333333334; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1376943408; 1; 2599.999334; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376943708; 1; 2599.999334; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376944008; 1; 2599.999334; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376944308; 1; 2599.999334; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376944608; 1; 2599.999334; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376944908; 1; 2599.999334; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376945208; 1; 2599.999334; 0.0; 0.0; 2097152.0; 62912.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376945508; 1; 2599.999334; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376945808; 1; 2599.999334; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.4; 0.0 +1376946108; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376946408; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 92272.8; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1376946708; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 195732.26666666666; 0.06666666666666667; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1376947008; 1; 2599.999334; 0.0; 0.0; 2097152.0; 121633.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376947309; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1376947609; 1; 2599.999334; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376947909; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376948209; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1376948509; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1376948809; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.6; 0.0; 0.0 +1376949109; 1; 2599.999334; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1376949408; 1; 2599.999334; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1376949709; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376950009; 1; 2599.999334; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1376950309; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 176158.4; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1376950609; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 149594.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376950909; 1; 2599.999334; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1376951209; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1376951509; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.2; 0.13333333333333333; 0.13333333333333333 +1376951809; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376952109; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1376952409; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 114642.93333333333; 0.0; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1376952709; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376953009; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1376953309; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1376953610; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376953910; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 137012.26666666666; 0.0; 2.0; 0.06666666666666667; 0.4666666666666667 +1376954210; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1376954510; 1; 2599.999334; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376954810; 1; 2599.999334; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376955110; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376955410; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.6; 0.0; 0.0 +1376955710; 1; 2599.999334; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376956010; 1; 2599.999334; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 1.2; 0.0; 0.0 +1376956310; 1; 2599.999334; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376956610; 1; 2599.999334; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376956910; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376957210; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376957510; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 176159.2; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1376957810; 1; 2599.999334; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.2; 0.0; 0.0 +1376958110; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 8.466666666666667; 0.0 +1376958410; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376958710; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 96467.2; 0.06666666666666667; 7.4; 0.26666666666666666; 0.2 +1376959010; 1; 2599.999334; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 0.7333333333333333; 0.0; 0.0 +1376959310; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1376959610; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376959910; 1; 2599.999334; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8; 0.0; 0.0 +1376960210; 1; 2599.999334; 0.0; 0.0; 2097152.0; 145401.86666666667; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1376960510; 1; 2599.999334; 0.0; 0.0; 2097152.0; 141206.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376960810; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1376961110; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 141205.86666666667; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1376961410; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.6; 0.06666666666666667; 0.0 +1376961710; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376962010; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1376962311; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1376962611; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1376962911; 1; 2599.999334; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1376963211; 1; 2599.999334; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1376963511; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 139808.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1376963811; 1; 2599.999334; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1376964111; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1376964411; 1; 2599.999334; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8; 0.0; 0.0 +1376964711; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 153789.86666666667; 0.0; 13.4; 0.06666666666666667; 0.4666666666666667 +1376965011; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 138410.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376965311; 1; 2599.999334; 0.0; 0.0; 2097152.0; 128623.46666666666; 0.0; 0.6; 0.0; 0.0 +1376965611; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 106254.13333333333; 0.0; 6.933333333333334; 0.26666666666666666; 0.13333333333333333 +1376965911; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1376966211; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376966511; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1376966811; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1376967111; 1; 2599.999334; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.6; 0.0; 0.0 +1376967411; 1; 2599.999334; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376967711; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1376968011; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 131419.46666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376968311; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 162177.86666666667; 0.06666666666666667; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1376968611; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 88078.4; 0.06666666666666667; 0.6666666666666666; 0.0; 0.0 +1376968911; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1376969211; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1376969511; 1; 2599.999334; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.6; 0.06666666666666667; 0.0 +1376969811; 1; 2599.999334; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376970111; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1376970411; 1; 2599.999334; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 1.2; 0.0; 0.0 +1376970711; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376971011; 1; 2599.999334; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376971311; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1376971611; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 130021.6; 12.733333333333333; 13.466666666666667; 0.3333333333333333; 0.2 +1376971911; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 156586.93333333332; 0.06666666666666667; 2.6; 0.06666666666666667; 0.4666666666666667 +1376972211; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376972512; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376972812; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1376973112; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 156585.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1376973412; 1; 2599.999334; 0.0; 0.0; 2097152.0; 149594.93333333332; 0.0; 0.6; 0.0; 0.0 +1376973712; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1376974012; 1; 2599.999334; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.6; 0.13333333333333333; 0.0 +1376974312; 1; 2599.999626; 28.599995886000002; 1.1; 2097152.0; 62912.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1376974612; 1; 2599.999626; 19.066663923999997; 0.7333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376974912; 1; 2599.999626; 13.866664671999999; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376975212; 1; 2599.999626; 17.333330840000002; 0.6666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.6; 0.0; 0.0 +1376975512; 1; 2599.999626; 19.066663923999997; 0.7333333333333333; 2097152.0; 191537.86666666667; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1376975812; 1; 2599.999334; 28.363629098181818; 1.0909090909090908; 2097152.0; 83884.0; 0.0; 0.9; 0.0; 0.0 +1376976112; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1376976412; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.6; 0.0; 0.0 +1376976712; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 74097.06666666667; 0.0; 0.6; 0.06666666666666667; 0.0 +1376977012; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.06666666666666667; 0.0 +1376977312; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 97865.33333333333; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1376977612; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 81087.73333333334; 0.0; 6.8; 0.2; 0.13333333333333333 +1376977912; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 116040.26666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1376978212; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376978512; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1376978812; 1; 2599.999334; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376979112; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 185945.6; 0.0; 2.0; 0.06666666666666667; 0.5333333333333333 +1376979412; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 148197.86666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1376979712; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6; 0.0; 0.0 +1376980012; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376980312; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.5333333333333333; 0.26666666666666666; 0.13333333333333333 +1376980612; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 146799.2; 0.0; 2.2; 0.06666666666666667; 0.0 +1376980912; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1376981212; 1; 2599.999334; 0.0; 0.0; 2097152.0; 137013.06666666668; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376981512; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1376981812; 1; 2599.999334; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.6; 0.2; 0.0 +1376982112; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 79689.6; 0.0; 0.6; 0.2; 0.0 +1376982412; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 128623.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1376982712; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 150994.4; 0.06666666666666667; 2.8666666666666667; 2.3333333333333335; 0.4666666666666667 +1376983012; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.06666666666666667; 6.533333333333333; 0.2; 0.13333333333333333 +1376983312; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 0.8; 0.0; 0.0 +1376983612; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.0; 0.0 +1376983912; 1; 2599.999334; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1376984212; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1376984512; 1; 2599.999334; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1376984812; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 111845.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1376985112; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1376985412; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.06666666666666667; 0.0 +1376985712; 1; 2599.999334; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1376986012; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.26666666666666666; 0.0 +1376986312; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 150993.06666666668; 0.0; 2.2666666666666666; 0.13333333333333333; 0.5333333333333333 +1376986612; 1; 2599.999334; 0.0; 0.0; 2097152.0; 144003.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1376986912; 1; 2599.999334; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376987212; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1376987512; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 113244.8; 1.3333333333333333; 4.0; 0.0; 0.0 +1376987812; 1; 2599.999334; 45.066655122666674; 1.7333333333333334; 2097152.0; 232082.4; 181.86666666666667; 31.2; 0.5333333333333333; 0.4 +1376988112; 1; 2599.999334; 41.59998934400001; 1.6; 2097152.0; 844450.9333333333; 0.0; 5.2; 0.0; 0.0 +1376988412; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 409641.3333333333; 31.8; 3.3333333333333335; 0.0; 0.0 +1376988712; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 244665.33333333334; 0.0; 2.533333333333333; 0.0; 0.0 +1376989012; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 184547.46666666667; 0.0; 7.666666666666667; 0.26666666666666666; 0.2 +1376989312; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 174761.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376989612; 1; 2599.999334; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 1.2666666666666666; 0.6666666666666666; 0.0 +1376989912; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 192935.73333333334; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1376990212; 1; 2599.999334; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1376990512; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1376990812; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376991112; 1; 2599.999334; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1376991412; 1; 2599.999334; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1376991712; 1; 2599.999334; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 0.8; 0.0; 0.0 +1376992012; 1; 2599.999334; 0.0; 0.0; 2097152.0; 128623.2; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1376992312; 1; 2599.999334; 0.0; 0.0; 2097152.0; 142604.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1376992612; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1376992913; 1; 2599.999334; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1376993213; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 104855.73333333334; 0.0; 1.5333333333333334; 0.06666666666666667; 0.4666666666666667 +1376993513; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 178955.2; 0.06666666666666667; 1.8; 0.0; 0.0 +1376993813; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1376994123; 1; 2599.999334; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376994423; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1376994724; 1; 2599.999334; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1376995024; 1; 2599.999334; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1376995324; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 183150.13333333333; 0.06666666666666667; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1376995624; 1; 2599.999334; 0.0; 0.0; 2097152.0; 130022.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1376995924; 1; 2599.999334; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1376996224; 1; 2599.999334; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1376996524; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1376996824; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 1.4; 0.06666666666666667; 0.4666666666666667 +1376997124; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 153789.06666666668; 0.0; 1.9333333333333333; 0.0; 0.0 +1376997424; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1376997724; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1376998024; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1376998324; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1376998624; 1; 2599.999334; 0.0; 0.0; 2097152.0; 137013.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1376998924; 1; 2599.999334; 0.0; 0.0; 2097152.0; 149596.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1376999224; 1; 2599.999334; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.3333333333333333; 0.2; 0.0 +1376999524; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1376999824; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8; 0.13333333333333333; 0.0 +1377000124; 1; 2599.999334; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377000424; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.7333333333333333; 0.4666666666666667 +1377000724; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 149595.46666666667; 0.0; 1.6; 0.0; 0.0 +1377001024; 1; 2599.999334; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377001324; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 146799.46666666667; 0.0; 6.666666666666667; 0.2; 0.13333333333333333 +1377001624; 1; 2599.999334; 0.0; 0.0; 2097152.0; 137012.0; 0.0; 0.8; 0.0; 0.0 +1377001924; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377002224; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377002524; 1; 2599.999334; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377002824; 1; 2599.999334; 0.0; 0.0; 2097152.0; 139808.8; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1377003125; 1; 2599.999334; 0.0; 0.0; 2097152.0; 130022.13333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377003425; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377003725; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377004025; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 124429.33333333333; 0.0; 1.4666666666666666; 0.06666666666666667; 0.4666666666666667 +1377004325; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 159382.13333333333; 0.13333333333333333; 1.8666666666666667; 0.06666666666666667; 0.0 +1377004625; 1; 2599.999334; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377004925; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1377005225; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.06666666666666667; 0.0 +1377005525; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377005825; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.06666666666666667; 0.0 +1377006125; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.0; 0.0 +1377006425; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377006725; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377007025; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120234.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377007325; 1; 2599.999334; 0.0; 0.0; 2097152.0; 137013.06666666668; 0.0; 0.6666666666666666; 0.0; 0.0 +1377007625; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 1.6; 0.06666666666666667; 0.4666666666666667 +1377007925; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 188741.86666666667; 0.06666666666666667; 7.733333333333333; 0.4666666666666667; 0.13333333333333333 +1377008225; 1; 2599.999334; 0.0; 0.0; 2097152.0; 137012.8; 0.0; 0.8; 0.0; 0.0 +1377008525; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 148197.33333333334; 0.0; 11.8; 0.06666666666666667; 0.0 +1377008825; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377009125; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 125828.0; 0.06666666666666667; 0.9333333333333333; 0.13333333333333333; 0.06666666666666667 +1377009425; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 139809.33333333334; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377009725; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377010025; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 120234.93333333333; 0.0; 0.7333333333333333; 1.0; 0.0 +1377010325; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.0; 0.0; 1.0; 0.2; 0.0 +1377010625; 1; 2599.999334; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8; 0.13333333333333333; 0.0 +1377010925; 1; 2599.999334; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377011226; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 1.1333333333333333; 0.13333333333333333; 0.4666666666666667 +1377011526; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 137013.06666666668; 0.0; 1.7333333333333334; 0.0; 0.0 +1377011826; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377012126; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377012426; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377012726; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.6; 0.06666666666666667; 0.0 +1377013026; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.2; 0.06666666666666667; 0.0 +1377013326; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.06666666666666667; 0.0 +1377013626; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.2; 0.0 +1377013926; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 176159.2; 0.0; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1377014226; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377014526; 1; 2599.999334; 0.0; 0.0; 2097152.0; 145401.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377014825; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 1.2; 0.06666666666666667; 0.4666666666666667 +1377015125; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 144003.73333333334; 0.0; 1.8666666666666667; 0.0; 0.0 +1377015425; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377015725; 1; 2599.999334; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377016025; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8; 0.0; 0.0 +1377016325; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.6; 0.0; 0.0 +1377016625; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377016925; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377017225; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377017526; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 0.8; 0.2; 0.0 +1377017826; 1; 2599.999334; 0.0; 0.0; 2097152.0; 162177.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377018126; 1; 2599.999334; 0.0; 0.0; 2097152.0; 146798.93333333332; 0.0; 0.8; 0.13333333333333333; 0.0 +1377018426; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.2; 0.0; 0.4666666666666667 +1377018726; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 171964.8; 0.06666666666666667; 1.9333333333333333; 0.0; 0.0 +1377019026; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377019326; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 110448.53333333334; 0.06666666666666667; 7.0; 1.4; 0.13333333333333333 +1377019626; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1377019926; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377020226; 1; 2599.999334; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1377020526; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377020826; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377021126; 1; 2599.999334; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8; 0.0; 0.0 +1377021426; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 135614.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1377021726; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1377022026; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 1.3333333333333333; 0.0; 0.4666666666666667 +1377022326; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 152391.46666666667; 0.0; 1.6666666666666667; 0.0; 0.0 +1377022626; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 120234.93333333333; 0.0; 0.8; 0.0; 0.0 +1377022926; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377023226; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377023526; 1; 2599.999334; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377023826; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1377024126; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.0; 0.0 +1377024426; 1; 2599.999334; 0.0; 0.0; 2097152.0; 128624.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377024726; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 121633.06666666667; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377025026; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.5333333333333333; 0.0; 0.0 +1377025326; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 2.2666666666666666; 0.0 +1377025627; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 1.3333333333333333; 0.13333333333333333; 0.4666666666666667 +1377025927; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 163576.8; 0.0; 7.6; 0.26666666666666666; 0.13333333333333333 +1377026227; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 142605.6; 0.0; 0.6; 0.06666666666666667; 0.0 +1377026527; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.6; 0.0; 0.0 +1377026827; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377027127; 1; 2599.999334; 43.33332223333333; 1.6666666666666665; 2097152.0; 510304.5333333333; 161.0; 14.333333333333334; 0.0; 0.2 +1377027427; 1; 2599.999334; 0.0; 0.0; 2097152.0; 223694.4; 0.0; 1.2; 0.0; 0.0 +1377027727; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 222296.8; 31.8; 3.6; 0.0; 0.0 +1377028027; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 1.2; 0.0; 0.0 +1377028327; 1; 2599.999334; 0.0; 0.0; 2097152.0; 144003.73333333334; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377028627; 1; 2599.999334; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377028927; 1; 2599.999334; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377029227; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 1.6; 0.06666666666666667; 0.4666666666666667 +1377029527; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 201324.0; 0.06666666666666667; 1.7333333333333334; 0.0; 0.0 +1377029827; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377030127; 1; 2599.999334; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377030427; 1; 2599.999334; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377030727; 1; 2599.999334; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377031027; 1; 2599.999334; 0.0; 0.0; 2097152.0; 128623.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377031327; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 124428.8; 12.8; 13.4; 0.3333333333333333; 0.13333333333333333 +1377031627; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 145401.06666666668; 0.0; 1.2666666666666666; 0.0; 0.0 +1377031927; 1; 2599.999334; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377032227; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377032527; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377032827; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.3333333333333333; 0.06666666666666667; 0.4666666666666667 +1377033127; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 160780.53333333333; 0.0; 1.6666666666666667; 0.0; 0.0 +1377033427; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 132817.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377033727; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377034027; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377034327; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377034627; 1; 2599.999334; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377034928; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377035228; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1377035528; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377035828; 1; 2599.999334; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1377036128; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 103457.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377036428; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 162177.86666666667; 0.0; 1.3333333333333333; 0.06666666666666667; 0.4666666666666667 +1377036728; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 233480.8; 0.13333333333333333; 2.066666666666667; 0.0; 0.0 +1377037028; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 141207.46666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377037328; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 132817.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377037628; 1; 2599.999334; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.5333333333333333; 0.0; 0.0 +1377037928; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 120234.66666666667; 0.0; 1.6; 0.13333333333333333; 0.13333333333333333 +1377038229; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 7.133333333333334; 0.26666666666666666; 0.13333333333333333 +1377038529; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377038829; 1; 2599.999334; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377039129; 1; 2599.999334; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377039429; 1; 2599.999334; 50.266653790666666; 1.9333333333333333; 2097152.0; 225093.06666666668; 161.0; 21.333333333333332; 0.06666666666666667; 0.4 +1377039729; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 724214.9333333333; 0.0; 2.2666666666666666; 0.0; 0.0 +1377040029; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 320164.0; 31.8; 4.0; 0.06666666666666667; 0.4666666666666667 +1377040329; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 229286.4; 0.06666666666666667; 2.2666666666666666; 0.0; 0.0 +1377040629; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 149595.46666666667; 0.0; 1.8; 0.0; 0.0 +1377040929; 1; 2599.999334; 0.0; 0.0; 2097152.0; 135614.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377041229; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1377041529; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 120234.66666666667; 0.06666666666666667; 0.9333333333333333; 0.0; 0.0 +1377041829; 1; 2599.999334; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1377042129; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377042429; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 90874.66666666667; 0.0; 1.9333333333333333; 0.0; 0.0 +1377042729; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377043029; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377043329; 1; 2599.999334; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6; 0.0; 0.0 +1377043629; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 1.5333333333333334; 0.06666666666666667; 0.4666666666666667 +1377043929; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 153790.66666666666; 0.0; 1.9333333333333333; 0.0; 0.0 +1377044229; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.0; 0.0 +1377044529; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377044829; 1; 2599.999334; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1377045129; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.4; 0.0; 0.0 +1377045429; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 88078.4; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1377045729; 1; 2599.999334; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377046029; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377046329; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1377046629; 1; 2599.999334; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.6; 0.0; 0.0 +1377046929; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377047230; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 127225.86666666667; 0.0; 1.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377047529; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 205517.86666666667; 0.0; 2.1333333333333333; 0.0; 0.0 +1377047829; 1; 2599.999334; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377048129; 1; 2599.999334; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377048429; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1377048729; 1; 2599.999334; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377049029; 1; 2599.999334; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377049329; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 71300.8; 0.0; 0.8; 0.0; 0.0 +1377049629; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.0; 0.0 +1377049929; 1; 2599.999334; 0.0; 0.0; 2097152.0; 114642.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377050229; 1; 2599.999334; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377050529; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.0; 0.0 +1377050829; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 72698.93333333333; 0.0; 1.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377051129; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 167770.4; 0.0; 1.4666666666666666; 0.0; 0.0 +1377051429; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377051729; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1377052029; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 17.933333333333334; 0.26666666666666666; 0.13333333333333333 +1377052329; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 71300.8; 0.0; 0.8; 0.0; 0.0 +1377052629; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377052929; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377053229; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 135614.13333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377053529; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377053830; 1; 2599.999334; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377054130; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377054430; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 109050.4; 0.0; 1.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1377054730; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 146799.2; 0.06666666666666667; 1.6666666666666667; 0.0; 0.0 +1377055030; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377055330; 1; 2599.999334; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377055630; 1; 2599.999334; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377055930; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377056230; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.6; 0.0; 0.0 +1377056530; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377056830; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1377057130; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104855.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377057430; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377057730; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377058030; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 109050.4; 0.06666666666666667; 7.2; 0.3333333333333333; 0.6666666666666666 +1377058330; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 176158.4; 0.0; 1.6666666666666667; 0.0; 0.0 +1377058630; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.06666666666666667; 0.0 +1377058930; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.6; 0.0; 0.0 +1377059230; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377059530; 1; 2599.999334; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377059830; 1; 2599.999334; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377060130; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 124429.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377060430; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377060730; 1; 2599.999334; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377061030; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377061330; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377061631; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.2; 0.06666666666666667; 0.4666666666666667 +1377061931; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 150994.4; 0.0; 1.5333333333333334; 0.0; 0.0 +1377062231; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 130021.6; 0.0; 0.8; 0.0; 0.0 +1377062531; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 109049.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377062831; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377063131; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1377063431; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1377063731; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 130022.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377064031; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 92272.8; 0.0; 6.733333333333333; 0.2; 0.13333333333333333 +1377064331; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 155187.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377064631; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377064931; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377065231; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.4666666666666666; 0.06666666666666667; 0.4666666666666667 +1377065531; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 180353.6; 0.26666666666666666; 1.7333333333333334; 0.0; 0.0 +1377065831; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 138411.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377066131; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.6; 0.0; 0.0 +1377066431; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1377066731; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 96467.2; 0.06666666666666667; 0.8666666666666667; 0.06666666666666667; 0.06666666666666667 +1377067031; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.9333333333333333; 0.0; 0.0 +1377067331; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 50328.8; 0.0; 1.4; 0.0; 0.0 +1377067631; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377067931; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.2; 0.0 +1377068231; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.2; 0.0 +1377068531; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.7333333333333334; 0.06666666666666667; 0.0 +1377068831; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.06666666666666667; 0.4666666666666667 +1377069131; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 146798.4; 0.0; 1.7333333333333334; 0.0; 0.0 +1377069432; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.06666666666666667; 0.0 +1377069732; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 113244.8; 0.0; 6.866666666666666; 0.6; 0.13333333333333333 +1377070032; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1377070332; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377070632; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 106254.13333333333; 0.0; 0.6; 0.0; 0.0 +1377070932; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1377071232; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.2; 0.0; 0.0 +1377071532; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377071832; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1377072132; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.6; 0.0; 0.0 +1377072432; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.2; 0.13333333333333333; 0.4666666666666667 +1377072732; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 155188.0; 0.0; 2.2666666666666666; 0.0; 0.0 +1377073032; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377073332; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 117439.2; 0.0; 0.6; 0.06666666666666667; 0.0 +1377073632; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.0; 0.0 +1377073932; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377074232; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 71300.8; 0.0; 0.6; 0.0; 0.0 +1377074532; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377074832; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377075132; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377075432; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377075732; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 71300.8; 0.0; 0.8; 0.0; 0.0 +1377076032; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 109050.13333333333; 0.0; 1.5333333333333334; 0.06666666666666667; 0.4666666666666667 +1377076332; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 176159.2; 0.0; 1.6666666666666667; 0.0; 0.0 +1377076632; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377076932; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 141207.46666666667; 0.0; 6.8; 0.2; 0.13333333333333333 +1377077232; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377077532; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377077832; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377078132; 1; 2599.999334; 17.333328893333338; 0.6666666666666667; 2097152.0; 152390.13333333333; 20.2; 2.3333333333333335; 0.0; 0.06666666666666667 +1377078432; 1; 2599.999334; 24.266660450666663; 0.9333333333333332; 2097152.0; 138410.4; 0.0; 4.133333333333334; 0.0; 0.0 +1377078732; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 125827.2; 0.2; 2.466666666666667; 0.0; 0.0 +1377079032; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 76893.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377079332; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377079632; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 96467.2; 0.0; 1.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1377079932; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 150993.33333333334; 0.0; 1.4; 0.0; 0.0 +1377080232; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377080532; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377080832; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 92272.8; 0.0; 1.7333333333333334; 0.0; 0.0 +1377081132; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377081432; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377081732; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377082032; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1377082332; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 137013.06666666668; 0.0; 1.0666666666666667; 0.0; 0.0 +1377082632; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377082932; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1377083232; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 124429.33333333333; 0.0; 7.533333333333333; 0.26666666666666666; 0.6666666666666666 +1377083532; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 206916.26666666666; 0.0; 1.8; 0.0; 0.0 +1377083832; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 144003.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377084132; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377084432; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377084732; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377085032; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 116041.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377085332; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1377085632; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 75495.2; 0.0; 1.2; 0.0; 0.0 +1377085932; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377086232; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377086532; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377086832; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 132818.66666666666; 0.0; 1.6; 0.06666666666666667; 0.4666666666666667 +1377087132; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 146799.2; 0.0; 1.6; 0.0; 0.0 +1377087432; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 104856.0; 0.0; 0.8; 0.2; 0.0 +1377087732; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377088032; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 82485.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377088332; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377088633; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377088933; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377089233; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 131419.73333333334; 12.733333333333333; 13.6; 0.4; 0.13333333333333333 +1377089533; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1377089833; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377090133; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1377090433; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 1.5333333333333334; 0.06666666666666667; 0.4666666666666667 +1377090733; 1; 2599.999334; 20.799994672000004; 0.8; 2097152.0; 169169.33333333334; 0.06666666666666667; 1.4; 0.06666666666666667; 0.0 +1377091033; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377091333; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.0; 0.0 +1377091633; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377091933; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377092233; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 0.6; 0.0; 0.0 +1377092533; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377092833; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377093133; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 69902.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377093433; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377093733; 1; 2599.999334; 62.399984016; 2.4; 2097152.0; 388670.93333333335; 161.06666666666666; 21.533333333333335; 0.13333333333333333; 0.4 +1377094033; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 581607.7333333333; 0.0; 4.2; 0.06666666666666667; 0.5333333333333333 +1377094333; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 320163.4666666667; 31.8; 4.333333333333333; 0.0; 0.0 +1377094633; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 216703.2; 0.06666666666666667; 8.533333333333333; 0.26666666666666666; 0.13333333333333333 +1377094933; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 142605.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1377095233; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 142604.53333333333; 0.0; 0.8; 0.0; 0.0 +1377095533; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 150993.6; 0.06666666666666667; 11.866666666666667; 0.06666666666666667; 0.06666666666666667 +1377095833; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 156586.13333333333; 0.0; 11.733333333333333; 0.0; 0.0 +1377096133; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1377096433; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377096733; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377097033; 1; 2599.999334; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377097333; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377097633; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 102059.46666666666; 0.0; 1.3333333333333333; 0.06666666666666667; 0.5333333333333333 +1377097933; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 215305.06666666668; 0.0; 1.8; 0.0; 0.0 +1377098234; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377098534; 1; 2599.999334; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377098834; 1; 2599.999334; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1377099134; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.6; 0.0; 0.0 +1377099434; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 76893.33333333333; 0.0; 0.8; 0.13333333333333333; 0.0 +1377099734; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377100034; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377100334; 1; 2599.999334; 0.0; 0.0; 2097152.0; 141206.66666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377100634; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.06666666666666667; 0.0 +1377100934; 1; 2599.999334; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6; 3.6666666666666665; 0.0 +1377101234; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 1.2666666666666666; 0.2; 0.4666666666666667 +1377101534; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 156586.13333333333; 0.06666666666666667; 8.2; 0.26666666666666666; 0.13333333333333333 +1377101834; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377102134; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.06666666666666667; 0.0 +1377102434; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6; 0.0; 0.0 +1377102734; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377103034; 1; 2599.999334; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377103334; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377103634; 1; 2599.999334; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377103934; 1; 2599.999334; 0.0; 0.0; 2097152.0; 54523.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377104234; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377104534; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 88078.4; 0.06666666666666667; 1.1333333333333333; 0.0; 0.0 +1377104834; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.13333333333333333; 0.4666666666666667 +1377105134; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 155187.2; 0.0; 0.8; 0.0; 0.0 +1377105434; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8; 0.06666666666666667; 0.0 +1377105735; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1377106035; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377106335; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 54523.2; 0.0; 0.6; 0.06666666666666667; 0.0 +1377106635; 1; 2599.999334; 0.0; 0.0; 2097152.0; 64310.13333333333; 0.0; 0.8; 0.0; 0.0 +1377106935; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1377107235; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 74097.06666666667; 0.0; 6.8; 0.26666666666666666; 0.2 +1377107535; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377107835; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377108135; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377108435; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 89476.26666666666; 0.0; 1.4; 0.06666666666666667; 0.4666666666666667 +1377108735; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 187342.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377109035; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377109335; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377109635; 1; 2599.999334; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377109935; 1; 2599.999334; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1377110235; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377110535; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1377110835; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 135614.93333333332; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377111135; 1; 2599.999334; 0.0; 0.0; 2097152.0; 132817.86666666667; 0.0; 1.0; 0.0; 0.0 +1377111435; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1377111735; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377112036; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 2.3333333333333335; 0.13333333333333333; 0.4666666666666667 +1377112336; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 125828.0; 0.0; 1.8; 0.0; 0.0 +1377112636; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377112935; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 1.5333333333333334; 0.06666666666666667; 0.0 +1377113235; 1; 2599.999334; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377113535; 1; 2599.999334; 46.799988012; 1.8; 2097152.0; 466963.73333333334; 161.2; 20.266666666666666; 0.2; 0.3333333333333333 +1377113835; 1; 2599.999334; 0.0; 0.0; 2097152.0; 255851.2; 0.0; 1.3333333333333333; 0.0; 0.0 +1377114135; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 167771.46666666667; 31.8; 3.6666666666666665; 0.0; 0.0 +1377114435; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 146799.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1377114735; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 134215.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377115035; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377115335; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 47532.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377115635; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 74097.06666666667; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377115935; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 1.0; 0.0; 0.0 +1377116235; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 135614.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377116535; 1; 2599.999334; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377116835; 1; 2599.999334; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.2; 0.0; 0.0 +1377117135; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377117435; 1; 2599.999334; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377117735; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1377118036; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377118336; 1; 2599.999334; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8; 0.0; 0.0 +1377118636; 1; 2599.999334; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377118936; 1; 2599.999334; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377119236; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 9.066666666666666; 0.4; 0.6 +1377119536; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 138411.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1377119836; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377120136; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377120436; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.2; 0.0 +1377120736; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377121036; 1; 2599.999334; 0.0; 0.0; 2097152.0; 152392.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377121336; 1; 2599.999334; 0.0; 0.0; 2097152.0; 111846.4; 0.0; 1.0; 0.0; 0.0 +1377121636; 1; 2599.999334; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377121936; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377122236; 1; 2599.999334; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.0; 0.0 +1377122537; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 109049.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377122837; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 2.1333333333333333; 0.2; 0.4666666666666667 +1377123137; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 185945.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377123437; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377123737; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377124037; 1; 2599.999334; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377124337; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.06666666666666667; 1.6; 0.06666666666666667; 0.13333333333333333 +1377124637; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 144002.93333333332; 0.0; 0.8; 0.0; 0.0 +1377124937; 1; 2599.999334; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1377125237; 1; 2599.999334; 20.799994672000004; 0.8; 2097152.0; 135614.13333333333; 169.73333333333332; 186.0; 0.2; 0.13333333333333333 +1377125537; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 260044.53333333333; 0.0; 0.8; 0.0; 0.0 +1377125837; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377126137; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 81087.73333333334; 0.7333333333333333; 1.2; 0.0; 0.0 +1377126437; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377126737; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 176158.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1377127037; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377127337; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377127637; 1; 2599.999334; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377127937; 1; 2599.999334; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377128237; 1; 2599.999334; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377128537; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377128837; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377129137; 1; 2599.999334; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1377129437; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377129737; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377130037; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 97864.8; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377130337; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 215304.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377130637; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 167770.93333333332; 0.0; 1.1333333333333333; 0.0; 0.0 +1377130937; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377131237; 1; 2599.999334; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377131537; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1377131837; 1; 2599.999334; 0.0; 0.0; 2097152.0; 141207.46666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377132138; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377132438; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 113244.8; 0.0; 6.8; 0.2; 0.13333333333333333 +1377132738; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377133038; 1; 2599.999334; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377133338; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377133638; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 1.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1377133938; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 135614.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377134238; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 76893.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377134538; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377134838; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377135138; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377135438; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 68504.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377135738; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 58717.6; 0.0; 1.0; 0.0; 0.0 +1377136038; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.0; 0.0 +1377136338; 1; 2599.999334; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377136638; 1; 2599.999334; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377136938; 1; 2599.999334; 0.0; 0.0; 2097152.0; 127225.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377137238; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 2.4; 0.06666666666666667; 0.5333333333333333 +1377137538; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 170565.86666666667; 0.06666666666666667; 1.1333333333333333; 0.0; 0.0 +1377137838; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1377138138; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377138438; 1; 2599.999334; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377138738; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 124429.86666666667; 0.06666666666666667; 7.133333333333334; 0.26666666666666666; 0.13333333333333333 +1377139038; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1377139338; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 11.8; 0.0; 0.0 +1377139638; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377139938; 1; 2599.999334; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1377140238; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377140538; 1; 2599.999334; 67.59998268400001; 2.6; 2097152.0; 669688.5333333333; 161.06666666666666; 22.0; 0.06666666666666667; 0.4 +1377140838; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 408244.26666666666; 0.0; 3.533333333333333; 0.0; 0.4666666666666667 +1377141138; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 258645.86666666667; 31.8; 3.533333333333333; 0.0; 0.0 +1377141438; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 149596.0; 0.0; 2.2666666666666666; 0.0; 0.0 +1377141738; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 160781.06666666668; 0.0; 1.9333333333333333; 0.0; 0.0 +1377142038; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 145400.8; 0.0; 0.8; 0.0; 0.0 +1377142338; 1; 2599.999334; 0.0; 0.0; 2097152.0; 148197.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377142638; 1; 2599.999334; 0.0; 0.0; 2097152.0; 128624.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377142938; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 144002.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1377143238; 1; 2599.999334; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377143538; 1; 2599.999334; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377143838; 1; 2599.999334; 0.0; 0.0; 2097152.0; 141207.46666666667; 0.0; 0.8; 0.0; 0.0 +1377144138; 1; 2599.999334; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 0.8; 0.0; 0.0 +1377144438; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 152391.73333333334; 0.0; 8.4; 0.26666666666666666; 0.6 +1377144738; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377145039; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377145339; 1; 2599.999334; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377145638; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1377145938; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377146238; 1; 2599.999334; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377146538; 1; 2599.999334; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377146838; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1377147138; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 86680.26666666666; 0.0; 1.0; 0.0; 0.0 +1377147438; 1; 2599.999334; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377147738; 1; 2599.999334; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377148038; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 2.4; 0.0; 0.5333333333333333 +1377148338; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 173362.93333333332; 0.06666666666666667; 0.7333333333333333; 0.0; 0.0 +1377148638; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 124429.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377148938; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377149238; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377149538; 1; 2599.999334; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377149839; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377150139; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377150439; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377150739; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377151039; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 173363.46666666667; 12.8; 13.4; 0.26666666666666666; 0.13333333333333333 +1377151339; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 142604.26666666666; 0.0; 1.4; 0.0; 0.0 +1377151639; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 107652.0; 0.0; 2.2; 0.0; 0.4666666666666667 +1377151939; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 209712.26666666666; 0.0; 0.6; 0.0; 0.0 +1377152239; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377152539; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377152839; 1; 2599.999334; 0.0; 0.0; 2097152.0; 117438.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377153139; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.06666666666666667; 0.13333333333333333 +1377153439; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 164973.86666666667; 0.0; 1.7333333333333334; 0.0; 0.0 +1377153739; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1377154039; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1377154339; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 116041.06666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1377154639; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 83884.0; 0.0; 0.6; 0.0; 0.0 +1377154939; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377155239; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1377155539; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 132817.86666666667; 0.06666666666666667; 1.0; 0.13333333333333333; 0.0 +1377155839; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 116041.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377156139; 1; 2599.999334; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377156439; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377156739; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377157039; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 96467.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377157339; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 128624.26666666666; 0.0; 8.2; 0.26666666666666666; 0.13333333333333333 +1377157639; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377157939; 1; 2599.999334; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.6; 0.13333333333333333; 0.0 +1377158239; 1; 2599.999334; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377158539; 1; 2599.999334; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.6; 0.06666666666666667; 0.0 +1377158839; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 100661.6; 0.06666666666666667; 2.466666666666667; 0.0; 0.4666666666666667 +1377159140; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 178955.46666666667; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377159440; 1; 2599.999334; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377159740; 1; 2599.999334; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377160040; 1; 2599.999334; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377160340; 1; 2599.999334; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.6; 0.0; 0.0 +1377160640; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377160940; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377161240; 1; 2599.999334; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377161540; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.6; 0.0; 0.0 +1377161840; 1; 2599.999334; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.6; 0.0; 0.0 +1377162140; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.6; 0.0; 0.0 +1377162439; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.2; 2.6666666666666665; 0.0; 0.4666666666666667 +1377162739; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 162177.86666666667; 0.0; 0.6; 0.0; 0.0 +1377163039; 1; 2599.999334; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1377163339; 1; 2599.999334; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.6; 0.0; 0.0 +1377163639; 1; 2599.999334; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.0; 0.0; 0.0 +1377163939; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 97865.33333333333; 0.0; 7.0; 0.2; 0.13333333333333333 +1377164239; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 81087.73333333334; 0.0; 0.5333333333333333; 0.0; 0.0 +1377164539; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 71300.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377164840; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377165140; 1; 2599.999334; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377165440; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377165740; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377166040; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 113244.53333333334; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377166340; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 184546.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377166640; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377166940; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377167240; 1; 2599.999334; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377167540; 1; 2599.999334; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377167840; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377168140; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 4.733333333333333; 0.0 +1377168440; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377168740; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377169040; 1; 2599.999334; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377169340; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377169640; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 2.3333333333333335; 0.13333333333333333; 0.4666666666666667 +1377169940; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 150993.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377170240; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 130021.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377170540; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377170840; 1; 2599.999334; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377171140; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 92272.8; 0.0; 6.8; 0.26666666666666666; 0.13333333333333333 +1377171440; 1; 2599.999334; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377171740; 1; 2599.999334; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377172041; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1377172341; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377172641; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377172941; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1377173241; 1; 2599.999334; 20.799994672000004; 0.8; 2097152.0; 83884.0; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1377173541; 1; 2599.999334; 19.066661782666664; 0.7333333333333333; 2097152.0; 159381.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377173841; 1; 2599.999334; 20.799994672000004; 0.8; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377174141; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377174441; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377174741; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377175041; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377175341; 1; 2599.999334; 19.066661782666664; 0.7333333333333333; 2097152.0; 75495.2; 0.0; 1.0; 0.0; 0.0 +1377175641; 1; 2599.999334; 17.333328893333338; 0.6666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377175941; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 149594.66666666666; 0.0; 1.0; 0.0; 0.0 +1377176241; 1; 2599.999334; 17.333328893333338; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1377176541; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377176841; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 92272.8; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377177141; 1; 2599.999334; 20.799994672000004; 0.8; 2097152.0; 142604.8; 0.0; 7.0; 0.26666666666666666; 0.2 +1377177441; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377177741; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377178041; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377178341; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1377178641; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377178941; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 93670.93333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1377179241; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377179541; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377179841; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1377180141; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377180441; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 142604.8; 0.0; 2.533333333333333; 0.0; 0.4666666666666667 +1377180741; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 134216.0; 0.0; 0.8; 0.0; 0.0 +1377181041; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377181341; 1; 2599.999334; 1.7333328893333333; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377181641; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377181941; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 99263.46666666666; 0.0; 1.2666666666666666; 0.06666666666666667; 0.13333333333333333 +1377182241; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 142604.0; 0.0; 0.8; 0.0; 0.0 +1377182542; 1; 2599.999334; 6.933331557333333; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377182842; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 85282.13333333333; 0.0; 11.733333333333333; 0.0; 0.0 +1377183142; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377183442; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 81087.73333333334; 0.0; 0.8; 0.0; 0.0 +1377183742; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1377184042; 1; 2599.999334; 5.199998668000001; 0.2; 2097152.0; 110448.53333333334; 0.06666666666666667; 2.4; 0.06666666666666667; 0.5333333333333333 +1377184342; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 155187.2; 0.0; 0.7333333333333333; 0.2; 0.0 +1377184642; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377184942; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377185242; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377185542; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377185842; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1377186142; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 0.8; 0.06666666666666667; 0.0 +1377186442; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377186742; 1; 2599.999334; 19.066661782666664; 0.7333333333333333; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377187042; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377187342; 1; 2599.999334; 17.333328893333338; 0.6666666666666667; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.0; 0.0 +1377187642; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 88078.4; 0.13333333333333333; 2.4; 0.06666666666666667; 0.4666666666666667 +1377187942; 1; 2599.999334; 19.066661782666664; 0.7333333333333333; 2097152.0; 163576.0; 0.0; 1.0; 0.0; 0.0 +1377188242; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377188542; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1377188842; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377189142; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377189442; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377189742; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 134216.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377190042; 1; 2599.999334; 17.333328893333338; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377190342; 1; 2599.999334; 19.066661782666664; 0.7333333333333333; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377190643; 1; 2599.999334; 12.133330225333331; 0.4666666666666666; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.13333333333333333; 0.0 +1377190943; 1; 2599.999334; 15.599996004; 0.6; 2097152.0; 83884.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377191243; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.06666666666666667; 2.1333333333333333; 0.13333333333333333; 0.4666666666666667 +1377191543; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 142605.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377191843; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377192143; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377192443; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377192743; 1; 2599.999334; 13.866663114666666; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377193043; 1; 2599.999297; 27.999992429230765; 1.0769230769230769; 2097152.0; 77431.07692307692; 0.0; 0.8333333333333334; 0.08333333333333333; 0.0 +1377193343; 1; 2599.999297; 17.33332864666667; 0.6666666666666667; 2097152.0; 72698.93333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1377193643; 1; 2599.999297; 34.66665729333334; 1.3333333333333335; 2097152.0; 100661.06666666667; 161.13333333333333; 20.6; 0.06666666666666667; 0.4 +1377193943; 1; 2599.999297; 55.46665166933333; 2.1333333333333333; 2097152.0; 746584.8; 0.0; 3.6666666666666665; 0.0; 0.0 +1377194243; 1; 2599.999297; 6.933331458666666; 0.26666666666666666; 2097152.0; 327154.13333333336; 31.8; 3.4; 0.06666666666666667; 0.0 +1377194543; 1; 2599.999297; 6.933331458666666; 0.26666666666666666; 2097152.0; 181752.53333333333; 0.0; 2.466666666666667; 0.0; 0.0 +1377194843; 1; 2599.999297; 20.799994376; 0.8; 2097152.0; 121633.6; 0.0; 9.2; 0.26666666666666666; 0.6666666666666666 +1377195143; 1; 2599.999297; 8.666664323333334; 0.33333333333333337; 2097152.0; 181751.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377195443; 1; 2599.999297; 8.666664323333334; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.0; 0.0 +1377195743; 1; 2599.999297; 8.666664323333334; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 0.8; 0.0; 0.0 +1377196043; 1; 2599.999297; 5.199998594; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1377196343; 1; 2599.999297; 8.666664323333334; 0.33333333333333337; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1377196643; 1; 2599.999297; 10.399997188; 0.4; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377196943; 1; 2599.999297; 15.599995781999999; 0.6; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377197243; 1; 2599.999297; 1.7333328646666666; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377197543; 1; 2599.999297; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1377197843; 1; 2599.999297; 1.7333328646666666; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377198143; 1; 2599.999297; 3.466665729333333; 0.13333333333333333; 2097152.0; 111845.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377198443; 1; 2599.999297; 3.466665729333333; 0.13333333333333333; 2097152.0; 103457.33333333333; 0.06666666666666667; 2.6; 0.06666666666666667; 0.5333333333333333 +1377198743; 1; 2599.999297; 10.399997188; 0.4; 2097152.0; 157982.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1377199043; 1; 2599.999297; 6.933331458666666; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377199343; 1; 2599.999297; 1.7333328646666666; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1377199643; 1; 2599.999297; 6.933331458666666; 0.26666666666666666; 2097152.0; 107651.46666666666; 0.0; 0.9333333333333333; 0.2; 0.0 +1377199943; 1; 2599.999297; 45.06665448133334; 1.7333333333333334; 2097152.0; 392864.0; 161.06666666666666; 14.4; 0.06666666666666667; 0.2 +1377200243; 1; 2599.999297; 10.399997188; 0.4; 2097152.0; 290802.6666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1377200543; 1; 2599.999297; 10.399997188; 0.4; 2097152.0; 243268.0; 31.8; 4.466666666666667; 0.0; 0.0 +1377200843; 1; 2599.999297; 12.133330052666665; 0.4666666666666666; 2097152.0; 171965.06666666668; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1377201143; 1; 2599.999297; 3.466665729333333; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1377201443; 1; 2599.999297; 5.199998594; 0.2; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377201743; 1; 2599.999297; 3.466665729333333; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377202043; 1; 2599.999297; 6.933331458666666; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 3.1333333333333333; 0.0; 0.4666666666666667 +1377202343; 1; 2599.999297; 10.399997188; 0.4; 2097152.0; 160779.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377202643; 1; 2599.999297; 3.466665729333333; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1377202943; 1; 2599.999297; 8.666664323333334; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377203243; 1; 2599.999306; 18.571423614285717; 0.7142857142857143; 2097152.0; 101860.0; 0.0; 0.9230769230769231; 1.9230769230769231; 0.0 +1377203543; 1; 2599.999306; 3.4666657413333337; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377203844; 1; 2599.999306; 1.7333328706666669; 0.06666666666666667; 2097152.0; 138410.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377204144; 1; 2599.999306; 0.0; 0.0; 2097152.0; 137012.26666666666; 0.0; 1.0; 0.0; 0.0 +1377204444; 1; 2599.999306; 3.4666657413333337; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377204744; 1; 2599.999306; 1.7333328706666669; 0.06666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377205044; 1; 2599.999306; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377205344; 1; 2599.999306; 3.4666657413333337; 0.13333333333333333; 2097152.0; 144002.93333333332; 0.0; 1.1333333333333333; 2.466666666666667; 0.0 +1377205644; 1; 2599.999306; 5.199998612000001; 0.2; 2097152.0; 117439.2; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377205944; 1; 2599.999306; 3.4666657413333337; 0.13333333333333333; 2097152.0; 170566.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377206244; 1; 2599.999306; 3.4666657413333337; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.2; 0.0 +1377206844; 1; 2599.999306; 8.666664353333335; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1377207144; 1; 2599.999306; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377207444; 1; 2599.999306; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377208044; 1; 2599.999306; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377208344; 1; 2599.999306; 3.4666657413333337; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377208644; 1; 2599.999306; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377208944; 1; 2599.999306; 8.666664353333335; 0.33333333333333337; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377209245; 1; 2599.999306; 5.199998612000001; 0.2; 2097152.0; 134216.0; 0.06666666666666667; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1377209845; 1; 2599.999306; 1.7333328706666669; 0.06666666666666667; 2097152.0; 123030.93333333333; 0.0; 1.0; 0.0; 0.0 +1377210145; 1; 2599.999601; 25.99999601; 1.0; 2097152.0; 102059.73333333334; 0.0; 0.8571428571428571; 0.0; 0.0 +1377210445; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377210745; 1; 2599.999601; 13.866664538666667; 0.5333333333333333; 2097152.0; 130021.6; 0.06666666666666667; 1.7333333333333334; 0.06666666666666667; 0.13333333333333333 +1377211045; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1377211345; 1; 2599.999601; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377211645; 1; 2599.999601; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377211945; 1; 2599.999601; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377212245; 1; 2599.999601; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377212545; 1; 2599.999601; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377212845; 1; 2599.999601; 8.666665336666668; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377213145; 1; 2599.999601; 15.599997605999999; 0.6; 2097152.0; 177557.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377213445; 1; 2599.999601; 17.333330673333336; 0.6666666666666667; 2097152.0; 135614.93333333332; 12.733333333333333; 13.266666666666667; 0.3333333333333333; 0.13333333333333333 +1377213745; 1; 2599.999601; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1377214045; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377214345; 1; 2599.999601; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377214645; 1; 2599.999601; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377214945; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377215245; 1; 2599.999601; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 1.2; 0.0; 0.0 +1377215545; 1; 2599.999601; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377215845; 1; 2599.999601; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377216145; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 130022.4; 0.0; 1.0; 0.0; 0.0 +1377216445; 1; 2599.999601; 10.399998404; 0.4; 2097152.0; 99263.46666666666; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377216745; 1; 2599.999601; 15.599997605999999; 0.6; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377217045; 1; 2599.999601; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377217345; 1; 2599.999601; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377217645; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 131419.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377217945; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 109049.6; 0.06666666666666667; 1.4666666666666666; 0.0; 0.0 +1377218245; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377218545; 1; 2599.999601; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377218845; 1; 2599.999601; 12.133331471333332; 0.4666666666666666; 2097152.0; 117438.4; 0.0; 1.0; 0.0; 0.0 +1377219145; 1; 2599.999601; 0.0; 0.0; 2097152.0; 142604.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377219445; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377219745; 1; 2599.999601; 6.9333322693333335; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 7.066666666666666; 0.2; 0.13333333333333333 +1377220045; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 118837.33333333333; 0.13333333333333333; 2.4; 0.0; 0.5333333333333333 +1377220345; 1; 2599.999601; 6.9333322693333335; 0.26666666666666666; 2097152.0; 163576.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377220646; 1; 2599.999601; 10.399998404; 0.4; 2097152.0; 85282.13333333333; 0.06666666666666667; 1.7333333333333334; 0.0; 0.0 +1377220946; 1; 2599.999601; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377221246; 1; 2599.999601; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377221546; 1; 2599.999601; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377221846; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 86680.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377222146; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377222446; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377222746; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1377223046; 1; 2599.999601; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377223346; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377223646; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 1.8666666666666667; 0.0; 0.4666666666666667 +1377223946; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 141206.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377224246; 1; 2599.999601; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377224546; 1; 2599.999601; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377224846; 1; 2599.999601; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377225146; 1; 2599.999601; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377225446; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377225746; 1; 2599.999601; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377226046; 1; 2599.999601; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377226346; 1; 2599.999601; 6.9333322693333335; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377226646; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 11.733333333333333; 0.0; 0.0 +1377226946; 1; 2599.999601; 0.0; 0.0; 2097152.0; 145401.86666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377227246; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 107652.0; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1377227546; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 183148.53333333333; 0.0; 1.0; 0.0; 0.0 +1377227846; 1; 2599.999601; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377228146; 1; 2599.999601; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377228446; 1; 2599.999601; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377228746; 1; 2599.999601; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377229046; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377229346; 1; 2599.999601; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1377229646; 1; 2599.999601; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.2; 0.0; 0.0 +1377229946; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377230246; 1; 2599.999601; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377230546; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1377230846; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 83884.0; 0.0; 2.1333333333333333; 0.0; 0.4666666666666667 +1377231146; 1; 2599.999601; 0.0; 0.0; 2097152.0; 150992.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377231446; 1; 2599.999601; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1377231746; 1; 2599.999601; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377232046; 1; 2599.999601; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377232346; 1; 2599.999601; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377232646; 1; 2599.999601; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377232946; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 170566.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377233246; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 125827.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377233547; 1; 2599.999601; 6.9333322693333335; 0.26666666666666666; 2097152.0; 155187.2; 0.2; 6.933333333333334; 0.2; 0.13333333333333333 +1377233847; 1; 2599.999309; 15.166662635833333; 0.5833333333333334; 2097152.0; 83884.0; 0.0; 1.0; 0.0; 0.0 +1377234147; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377234447; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1377234747; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 171964.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377235047; 1; 2599.999309; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377235347; 1; 2599.999309; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.6; 0.0; 0.0 +1377235647; 1; 2599.999309; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1377235947; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377236247; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.6; 0.0; 0.0 +1377236547; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377236847; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 125827.2; 0.0; 1.0; 0.06666666666666667; 0.0 +1377237147; 1; 2599.999309; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1377237447; 1; 2599.999309; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1377237747; 1; 2599.999309; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6; 0.0; 0.0 +1377238047; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 2.066666666666667; 0.0; 0.4666666666666667 +1377238347; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 146798.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377238647; 1; 2599.999309; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377238947; 1; 2599.999309; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377239247; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 150992.8; 0.0; 6.666666666666667; 0.3333333333333333; 0.13333333333333333 +1377239547; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.2666666666666666; 0.06666666666666667; 0.06666666666666667 +1377239847; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 121633.6; 0.0; 1.8; 0.0; 0.0 +1377240147; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 149595.46666666667; 0.0; 1.6666666666666667; 0.13333333333333333; 0.0 +1377240447; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.5333333333333333; 0.0; 0.0 +1377240747; 1; 2599.999309; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377241047; 1; 2599.999309; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377241347; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.4; 0.0; 0.0 +1377241647; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 2.0; 0.06666666666666667; 0.4666666666666667 +1377241947; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 192936.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377242247; 1; 2599.999309; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377242547; 1; 2599.999309; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1377242848; 1; 2599.999309; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.6; 0.0; 0.0 +1377243148; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377243448; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377243748; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 76893.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377244048; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1377244347; 1; 2599.999309; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.6; 0.06666666666666667; 0.0 +1377244647; 1; 2599.999309; 57.199984798; 2.2; 2097152.0; 736797.0666666667; 161.0; 21.866666666666667; 0.13333333333333333; 0.4 +1377244947; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 394262.4; 0.0; 2.466666666666667; 0.06666666666666667; 0.0 +1377245247; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 247461.6; 32.06666666666667; 4.8; 0.0; 0.4666666666666667 +1377245547; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 197130.4; 0.0; 2.4; 0.06666666666666667; 0.0 +1377245847; 1; 2599.999309; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.4; 0.0; 0.0 +1377246147; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 6.666666666666667; 0.3333333333333333; 0.2 +1377246447; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 138410.4; 0.0; 1.4; 1.2666666666666666; 0.0 +1377246748; 1; 2599.999309; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377247048; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377247348; 1; 2599.999309; 0.0; 0.0; 2097152.0; 142605.6; 0.0; 0.6; 0.0; 0.0 +1377247648; 1; 2599.999309; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1377247948; 1; 2599.999309; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377248248; 1; 2599.999309; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1377248548; 1; 2599.999309; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377248848; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377249148; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 176158.4; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377249448; 1; 2599.999309; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377249748; 1; 2599.999309; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377250048; 1; 2599.999309; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377250348; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377250648; 1; 2599.999309; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377250948; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 1.2; 0.0; 0.0 +1377251248; 1; 2599.999309; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377251548; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377251848; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 97865.33333333333; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1377252148; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 163576.0; 0.0; 1.0; 0.06666666666666667; 0.0 +1377252448; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.06666666666666667; 2.3333333333333335; 0.0; 0.4666666666666667 +1377252748; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377253048; 1; 2599.999309; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377253348; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377253648; 1; 2599.999309; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1377253948; 1; 2599.999309; 0.0; 0.0; 2097152.0; 65708.26666666666; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377254248; 1; 2599.999309; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377254548; 1; 2599.999309; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377254848; 1; 2599.999309; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377255148; 1; 2599.999309; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377255448; 1; 2599.999309; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377255748; 1; 2599.999309; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377256048; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1377256348; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 163576.0; 0.0; 1.2; 0.0; 0.0 +1377256648; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377256948; 1; 2599.999309; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377257249; 1; 2599.999309; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377257549; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1377257849; 1; 2599.999309; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377258149; 1; 2599.999309; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377258449; 1; 2599.999309; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377258749; 1; 2599.999309; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377259049; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 118837.33333333333; 0.06666666666666667; 7.066666666666666; 0.2; 0.13333333333333333 +1377259349; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 148197.33333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377259649; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 2.2666666666666666; 0.13333333333333333; 0.4666666666666667 +1377259949; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 155186.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1377260249; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 117438.13333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377260549; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 156585.86666666667; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1377260849; 1; 2599.999309; 0.0; 0.0; 2097152.0; 145401.06666666668; 0.0; 0.8666666666666667; 0.8666666666666667; 0.0 +1377261149; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 82.06666666666666; 0.0 +1377261449; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377261749; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377262049; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377262349; 1; 2599.999309; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1377262649; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377262949; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377263249; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 139808.53333333333; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377263549; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 197130.4; 0.0; 1.0; 0.0; 0.0 +1377263849; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377264149; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.8; 0.0; 0.0 +1377264449; 1; 2599.999309; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377264749; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 113244.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377265049; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 81087.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377265349; 1; 2599.999309; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1377265649; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 116041.06666666667; 0.0; 7.133333333333334; 0.3333333333333333; 0.13333333333333333 +1377265949; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1377266249; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 127226.13333333333; 0.0; 1.2; 0.0; 0.0 +1377266549; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377266849; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 107651.73333333334; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377267149; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 188742.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377267449; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.0; 0.0 +1377267749; 1; 2599.999309; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377268049; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377268349; 1; 2599.999309; 15.599995854; 0.6; 2097152.0; 90874.66666666667; 0.06666666666666667; 1.4; 0.06666666666666667; 0.13333333333333333 +1377268649; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377268949; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1377269249; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377269549; 1; 2599.999309; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377269849; 1; 2599.999309; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377270149; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 97865.33333333333; 0.0; 11.933333333333334; 0.13333333333333333; 0.0 +1377270449; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 93670.4; 0.4666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377270749; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 137012.8; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377271049; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377271349; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 117438.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377271649; 1; 2599.999309; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377271950; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377272250; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377272550; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 121633.6; 12.733333333333333; 16.733333333333334; 0.3333333333333333; 0.13333333333333333 +1377272850; 1; 2599.999309; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.6; 0.0; 0.0 +1377273150; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.2; 0.0; 0.0 +1377273450; 1; 2599.999309; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1377273750; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377274050; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1377274350; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 114642.4; 0.0; 1.0; 0.0; 0.0 +1377274650; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 144002.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377274950; 1; 2599.999309; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377275250; 1; 2599.999309; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377275550; 1; 2599.999309; 0.0; 0.0; 2097152.0; 130021.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377275850; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 132818.4; 0.0; 1.2; 0.0; 0.0 +1377276150; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377276450; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377276750; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377277050; 1; 2599.999309; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377277350; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 130021.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377277650; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 131420.26666666666; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377277950; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 142604.0; 0.0; 0.8; 0.0; 0.0 +1377278250; 1; 2599.999309; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1377278550; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1377278850; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377279150; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 0.8; 0.0; 0.0 +1377279450; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 128624.26666666666; 0.0; 6.866666666666666; 0.26666666666666666; 0.2 +1377279750; 1; 2599.999309; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377280050; 1; 2599.999309; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377280350; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377280650; 1; 2599.999309; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377280950; 1; 2599.999309; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1377281250; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 99262.93333333333; 0.0; 2.533333333333333; 0.13333333333333333; 0.4666666666666667 +1377281551; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 171964.0; 0.06666666666666667; 1.0666666666666667; 0.06666666666666667; 0.0 +1377281851; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 153790.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377282151; 1; 2599.999309; 0.0; 0.0; 2097152.0; 145401.06666666668; 0.0; 0.8; 0.0; 0.0 +1377282451; 1; 2599.999309; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377282751; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377283051; 1; 2599.999309; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377283351; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 178955.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377283651; 1; 2599.999309; 0.0; 0.0; 2097152.0; 137012.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377283951; 1; 2599.999309; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377284251; 1; 2599.999309; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.2; 0.13333333333333333; 0.0 +1377284551; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 65708.26666666666; 0.0; 0.8; 0.0; 0.0 +1377284851; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 100661.6; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377285151; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 159382.4; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1377285451; 1; 2599.999309; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377285751; 1; 2599.999309; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377286051; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1377286351; 1; 2599.999309; 38.13332319866666; 1.4666666666666666; 2097152.0; 430614.4; 161.53333333333333; 14.333333333333334; 0.0; 0.2 +1377286651; 1; 2599.999309; 0.0; 0.0; 2097152.0; 394262.6666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1377286951; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 197129.86666666667; 31.8; 3.933333333333333; 0.0; 0.0 +1377287251; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 155187.73333333334; 0.0; 1.2; 0.06666666666666667; 0.0 +1377287551; 1; 2599.999309; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377287851; 1; 2599.999309; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377288151; 1; 2599.999309; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377288451; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 139808.8; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377288751; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 181750.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377289051; 1; 2599.999309; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8; 0.0; 0.0 +1377289351; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377289651; 1; 2599.999309; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377289951; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377290251; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1377290551; 1; 2599.999309; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377290852; 1; 2599.999309; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.6666666666666667; 0.0; 0.0 +1377291152; 1; 2599.999309; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377291452; 1; 2599.999309; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1377291752; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 110448.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377292052; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 139808.26666666666; 0.0; 8.466666666666667; 0.3333333333333333; 0.6 +1377292352; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 177556.0; 0.0; 1.2; 0.0; 0.0 +1377292652; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 149596.26666666666; 0.0; 0.8; 0.0; 0.0 +1377292952; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377293251; 1; 2599.999309; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377293551; 1; 2599.999309; 55.46665192533332; 2.1333333333333333; 2097152.0; 268433.6; 161.0; 21.533333333333335; 0.06666666666666667; 0.4 +1377293851; 1; 2599.999309; 15.599995854; 0.6; 2097152.0; 717224.2666666667; 0.0; 2.6666666666666665; 0.0; 0.0 +1377294151; 1; 2599.999309; 12.133330108666664; 0.4666666666666666; 2097152.0; 317366.93333333335; 31.8; 3.6; 0.0; 0.0 +1377294451; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 212508.53333333333; 0.0; 2.1333333333333333; 0.0; 0.0 +1377294751; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 121633.6; 0.0; 1.8; 0.0; 0.0 +1377295051; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.8; 0.0; 0.0 +1377295352; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1377295652; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1377295952; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 153789.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377296252; 1; 2599.999309; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.8; 0.0; 0.0 +1377296552; 1; 2599.999309; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377296852; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1377297152; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.3333333333333333; 0.06666666666666667; 0.13333333333333333 +1377297452; 1; 2599.999309; 13.86666298133333; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 6.933333333333334; 0.26666666666666666; 0.13333333333333333 +1377297752; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 121632.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377298052; 1; 2599.999309; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377298352; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377298652; 1; 2599.999309; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377298952; 1; 2599.999309; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377299252; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 127225.86666666667; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377299552; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 166371.73333333334; 0.0; 0.8; 0.0; 0.0 +1377299852; 1; 2599.999309; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377300152; 1; 2599.999309; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377300452; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377300752; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 142605.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377301052; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.26666666666666666; 0.0 +1377301352; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377301652; 1; 2599.999309; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377301952; 1; 2599.999309; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377302252; 1; 2599.999309; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1377302552; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1377302852; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 116041.06666666667; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1377303152; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 188741.6; 0.0; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1377303452; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1377303752; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1377304052; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377304352; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 157984.26666666666; 0.06666666666666667; 1.4; 0.0; 0.0 +1377304652; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377304953; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 76893.33333333333; 0.0; 1.2; 0.0; 0.0 +1377305253; 1; 2599.999309; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8; 0.0; 0.0 +1377305553; 1; 2599.999309; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377305853; 1; 2599.999309; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.0; 0.0 +1377306153; 1; 2599.999309; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377306453; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377306753; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 127225.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377307053; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 120234.66666666667; 0.0; 0.8; 0.0; 0.0 +1377307353; 1; 2599.999309; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.8; 0.0; 0.0 +1377307653; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377307953; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1377308253; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1377308553; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377308853; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1377309153; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1377309453; 1; 2599.999309; 0.0; 0.0; 2097152.0; 149596.0; 0.0; 0.6; 0.0; 0.0 +1377309753; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 114642.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377310053; 1; 2599.999309; 15.599995854; 0.6; 2097152.0; 121633.33333333333; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377310353; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 171965.06666666668; 0.0; 1.2; 0.0; 0.0 +1377310653; 1; 2599.999309; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377310953; 1; 2599.999309; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.6; 0.0; 0.0 +1377311253; 1; 2599.999309; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.6; 0.13333333333333333; 0.0 +1377311553; 1; 2599.999309; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1377311853; 1; 2599.999309; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377312153; 1; 2599.999309; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377312453; 1; 2599.999309; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1377312753; 1; 2599.999309; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.6; 0.0; 0.0 +1377313053; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377313353; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377313653; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 162178.13333333333; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1377313953; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 164974.4; 0.0; 11.6; 0.0; 0.0 +1377314253; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377314553; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377314853; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377315154; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377315454; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377315754; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 139807.73333333334; 0.0; 6.933333333333334; 0.26666666666666666; 0.2 +1377316054; 1; 2599.999309; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.2; 0.0; 0.0 +1377316354; 1; 2599.999309; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.6; 0.0; 0.0 +1377316654; 1; 2599.999309; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.6; 0.0; 0.0 +1377316954; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377317254; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 124429.6; 0.13333333333333333; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377317554; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 180353.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377317854; 1; 2599.999309; 0.0; 0.0; 2097152.0; 144003.2; 0.0; 0.8; 0.0; 0.0 +1377318154; 1; 2599.999309; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377318454; 1; 2599.999309; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.0; 0.0 +1377318754; 1; 2599.999309; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377319054; 1; 2599.999309; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1377319354; 1; 2599.999309; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.0; 0.0; 0.0 +1377319654; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377319954; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377320254; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 74097.06666666667; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377320554; 1; 2599.999309; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377320854; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.06666666666666667; 2.0; 0.06666666666666667; 0.4666666666666667 +1377321154; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 171963.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377321454; 1; 2599.999309; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377321754; 1; 2599.999309; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1377322054; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 128624.26666666666; 0.0; 6.6; 0.26666666666666666; 0.13333333333333333 +1377322354; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 131420.53333333333; 0.0; 0.6; 0.0; 0.0 +1377322655; 1; 2599.999309; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6; 0.0; 0.0 +1377322955; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377323255; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 1.0; 0.0; 0.0 +1377323555; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377323855; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377324155; 1; 2599.999309; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1377324455; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 109050.4; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1377324755; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377325055; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377325355; 1; 2599.999309; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377325655; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377325955; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.13333333333333333; 0.06666666666666667 +1377326255; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 146799.2; 0.0; 1.9333333333333333; 0.0; 0.0 +1377326554; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 134216.8; 0.0; 1.7333333333333334; 0.0; 0.0 +1377326854; 1; 2599.999309; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 1.0; 0.0; 0.0 +1377327154; 1; 2599.999309; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377327454; 1; 2599.999309; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377327755; 1; 2599.999309; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377328055; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 134216.8; 0.06666666666666667; 8.6; 0.26666666666666666; 0.6 +1377328355; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 146800.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1377328655; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377328955; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377329255; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377329555; 1; 2599.999309; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377329855; 1; 2599.999309; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377330155; 1; 2599.999309; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 1.2; 0.0; 0.0 +1377330455; 1; 2599.999309; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.2; 0.0; 0.0 +1377330755; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377331055; 1; 2599.999309; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377331355; 1; 2599.999309; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377331655; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.06666666666666667; 1.9333333333333333; 0.13333333333333333; 0.5333333333333333 +1377331955; 1; 2599.999309; 12.133330108666664; 0.4666666666666666; 2097152.0; 176158.4; 0.0; 1.0; 0.0; 0.0 +1377332255; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377332555; 1; 2599.999309; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377332855; 1; 2599.999309; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377333155; 1; 2599.999309; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377333455; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377333755; 1; 2599.999309; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377334055; 1; 2599.999309; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377334355; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 132818.66666666666; 12.733333333333333; 14.066666666666666; 0.3333333333333333; 0.2 +1377334655; 1; 2599.999309; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.2; 0.0; 0.0 +1377334955; 1; 2599.999309; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377335255; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 2.6666666666666665; 0.0; 0.4666666666666667 +1377335555; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 150993.6; 0.0; 1.7333333333333334; 0.0; 0.0 +1377335855; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377336155; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377336455; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377336755; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1377337055; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377337355; 1; 2599.999309; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1377337655; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377337955; 1; 2599.999309; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377338255; 1; 2599.999309; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377338555; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1377338855; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377339156; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377339456; 1; 2599.999309; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0; 0.0; 0.0 +1377339756; 1; 2599.999309; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377340056; 1; 2599.999309; 0.0; 0.0; 2097152.0; 57319.46666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377340356; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377340656; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377340956; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377341256; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1377341556; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377341856; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377342156; 1; 2599.999309; 1.7333328726666664; 0.06666666666666667; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377342456; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 107652.0; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377342756; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 180353.6; 0.0; 1.0; 0.0; 0.0 +1377343056; 1; 2599.999309; 64.13331628866666; 2.466666666666667; 2097152.0; 328552.5333333333; 161.06666666666666; 21.533333333333335; 0.2; 0.4 +1377343356; 1; 2599.999309; 15.599995854; 0.6; 2097152.0; 658504.0; 0.0; 2.533333333333333; 0.0; 0.0 +1377343656; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 268433.6; 31.8; 3.7333333333333334; 0.0; 0.0 +1377343956; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 167771.2; 0.0; 2.1333333333333333; 0.0; 0.0 +1377344256; 1; 2599.999309; 10.399997235999999; 0.4; 2097152.0; 109050.4; 0.0; 1.5333333333333334; 0.0; 0.0 +1377344556; 1; 2599.999309; 0.0; 0.0; 2097152.0; 113244.0; 0.0; 1.0; 0.0; 0.0 +1377344856; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377345156; 1; 2599.999309; 3.4666657453333327; 0.13333333333333333; 2097152.0; 141207.46666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377345456; 1; 2599.999309; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377345756; 1; 2599.999309; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377346056; 1; 2599.999309; 5.1999986179999995; 0.2; 2097152.0; 110448.53333333334; 0.0; 1.9333333333333333; 0.06666666666666667; 0.4666666666666667 +1377346356; 1; 2599.999309; 8.666664363333334; 0.33333333333333337; 2097152.0; 159381.6; 0.06666666666666667; 1.1333333333333333; 0.0; 0.0 +1377346656; 1; 2599.999309; 6.933331490666665; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377346956; 1; 2599.999309; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.8; 0.06666666666666667; 0.0 +1377347256; 1; 2599.999601; 11.999998158461537; 0.4615384615384615; 2097152.0; 79044.30769230769; 0.0; 0.9166666666666666; 0.0; 0.0 +1377347556; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 107652.26666666666; 0.0; 6.866666666666666; 0.26666666666666666; 0.2 +1377347856; 1; 2599.99931; 25.9999931; 1.0; 2097152.0; 116840.0; 0.0; 0.8461538461538461; 0.0; 0.0 +1377348156; 1; 2599.99931; 13.866662986666668; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377348456; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377348757; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377349057; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 89476.53333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377349357; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 85282.13333333333; 0.0; 0.8; 0.0; 0.0 +1377349657; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 142605.06666666668; 0.06666666666666667; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377349957; 1; 2599.99931; 13.866662986666668; 0.5333333333333333; 2097152.0; 162178.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377350257; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377350557; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1377350857; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1377351157; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377351457; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377351757; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 139808.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377352057; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377352357; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377352657; 1; 2599.99931; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377352957; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377353257; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 127226.13333333333; 0.06666666666666667; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1377353557; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 169169.33333333334; 0.0; 7.066666666666666; 0.2; 0.13333333333333333 +1377353857; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377354157; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377354457; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377354757; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 72698.93333333333; 0.06666666666666667; 1.1333333333333333; 0.06666666666666667; 0.13333333333333333 +1377355057; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377355357; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 95069.06666666667; 0.0; 1.8; 0.26666666666666666; 0.0 +1377355657; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.06666666666666667; 0.0 +1377355957; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1377356257; 1; 2599.99931; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1377356557; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 138411.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377356857; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 109050.4; 0.0; 2.2; 0.0; 0.4666666666666667 +1377357157; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 146798.4; 0.0; 1.5333333333333334; 0.0; 0.0 +1377357457; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 127226.13333333333; 0.0; 11.933333333333334; 0.0; 0.0 +1377357757; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 130021.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377358057; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1377358357; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377358658; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 86680.26666666666; 0.0; 1.0; 0.0; 0.0 +1377358957; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 88078.4; 0.0; 1.0; 0.06666666666666667; 0.0 +1377359257; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1377359557; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377359857; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377360157; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1377360457; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 110448.53333333334; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1377360757; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 163576.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377361057; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377361357; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377361657; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377361957; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377362257; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.0; 0.0 +1377362557; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377362857; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 81087.73333333334; 0.0; 1.2; 0.0; 0.0 +1377363157; 1; 2599.99931; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377363457; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1377363757; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 76893.33333333333; 0.0; 0.6; 0.0; 0.0 +1377364057; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 103457.06666666667; 0.06666666666666667; 2.2666666666666666; 0.0; 0.4666666666666667 +1377364357; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 164974.66666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377364657; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.5333333333333333; 0.0; 0.0 +1377364957; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1377365257; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377365558; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377365858; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377366158; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377366458; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377366758; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 145401.06666666668; 0.06666666666666667; 7.066666666666666; 0.2; 0.13333333333333333 +1377367058; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377367358; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377367658; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 88078.4; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377367958; 1; 2599.99931; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377368258; 1; 2599.99931; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377368558; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377368858; 1; 2599.99931; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.5333333333333333; 0.0; 0.0 +1377369158; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377369458; 1; 2599.99931; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.6666666666666666; 0.26666666666666666; 0.0 +1377369758; 1; 2599.99931; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.9333333333333333; 0.0 +1377370058; 1; 2599.99931; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.8; 0.0; 0.0 +1377370358; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377370658; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377370958; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 81087.73333333334; 0.0; 0.6; 0.0; 0.0 +1377371258; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 86680.26666666666; 0.0; 2.4; 0.0; 0.4666666666666667 +1377371558; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 174761.06666666668; 0.0; 0.6666666666666666; 0.0; 0.0 +1377371858; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377372158; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377372458; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377372758; 1; 2599.99931; 41.59998896; 1.6; 2097152.0; 369097.3333333333; 161.0; 14.266666666666667; 0.0; 0.2 +1377373058; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 426419.2; 0.0; 7.2; 0.2; 0.13333333333333333 +1377373358; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 208315.46666666667; 31.8; 3.4; 0.06666666666666667; 0.0 +1377373658; 1; 2599.99931; 0.0; 0.0; 2097152.0; 178954.93333333332; 0.0; 1.1333333333333333; 0.0; 0.0 +1377373958; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377374259; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.06666666666666667; 0.0 +1377374559; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377374859; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 106254.13333333333; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1377375159; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 152391.73333333334; 0.0; 0.8; 0.0; 0.0 +1377375459; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377375759; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377376059; 1; 2599.99931; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377376359; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377376659; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377376959; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377377259; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377377559; 1; 2599.99931; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377377859; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377378159; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 96467.2; 0.6666666666666666; 1.5333333333333334; 0.0; 0.0 +1377378459; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 100661.33333333333; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1377378759; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 159381.86666666667; 0.0; 0.8; 0.0; 0.0 +1377379059; 1; 2599.99931; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377379359; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 75495.2; 0.06666666666666667; 7.2; 0.2; 0.13333333333333333 +1377379659; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1377379959; 1; 2599.99931; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.5333333333333334; 0.0; 0.0 +1377380259; 1; 2599.99931; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377380559; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377380859; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377381159; 1; 2599.99931; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 0.8; 0.0; 0.0 +1377381459; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377381759; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377382059; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 99262.66666666667; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377382359; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 184547.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377382659; 1; 2599.99931; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377382959; 1; 2599.99931; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377383259; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377383559; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 90874.66666666667; 0.0; 1.7333333333333334; 0.06666666666666667; 0.13333333333333333 +1377383859; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1377384159; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1377384459; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377384759; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377385059; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 113244.8; 0.06666666666666667; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1377385360; 1; 2599.99931; 0.0; 0.0; 2097152.0; 139808.53333333333; 0.0; 0.6; 0.0; 0.0 +1377385660; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 138411.2; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1377385960; 1; 2599.99931; 0.0; 0.0; 2097152.0; 138410.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377386260; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1377386560; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1377386860; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.0; 0.0; 0.8; 0.0; 0.0 +1377387160; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 142604.8; 0.0; 0.8; 0.0; 0.0 +1377387460; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377387760; 1; 2599.99931; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377388060; 1; 2599.99931; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 1.0; 0.0; 0.0 +1377388360; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377388660; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377388960; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.6; 0.0; 0.0 +1377389260; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 130021.86666666667; 0.0; 2.8; 0.0; 0.4666666666666667 +1377389560; 1; 2599.99931; 0.0; 0.0; 2097152.0; 178954.13333333333; 0.0; 0.8; 0.0; 0.0 +1377389860; 1; 2599.99931; 0.0; 0.0; 2097152.0; 137013.06666666668; 0.0; 0.6; 0.0; 0.0 +1377390160; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1377390460; 1; 2599.99931; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377390760; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 61513.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1377391060; 1; 2599.99931; 0.0; 0.0; 2097152.0; 120234.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377391360; 1; 2599.99931; 57.19998482000001; 2.2; 2097152.0; 357911.73333333334; 161.0; 21.733333333333334; 0.06666666666666667; 0.3333333333333333 +1377391660; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 665494.4; 0.0; 2.2666666666666666; 0.0; 0.0 +1377391961; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 247461.06666666668; 44.6; 15.8; 0.3333333333333333; 0.2 +1377392261; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 178954.66666666666; 0.0; 2.466666666666667; 0.0; 0.0 +1377392561; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 146800.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1377392861; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 121633.33333333333; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377393161; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 174760.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377393461; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 1.2; 0.0; 0.0 +1377393761; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 74097.06666666667; 0.0; 0.6; 0.0; 0.0 +1377394061; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6; 0.0; 0.0 +1377394361; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377394661; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.2; 0.0; 0.0 +1377394961; 1; 2599.99931; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377395261; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.0; 0.0 +1377395561; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6; 0.0; 0.0 +1377395861; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377396161; 1; 2599.99931; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377396461; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 120235.46666666666; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377396761; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 162178.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377397061; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377397361; 1; 2599.99931; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.2; 0.0; 0.0 +1377397661; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377397961; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377398261; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377398561; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 148197.06666666668; 0.0; 7.2; 0.2; 0.13333333333333333 +1377398861; 1; 2599.99931; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377399161; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377399461; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377399761; 1; 2599.99931; 0.0; 0.0; 2097152.0; 62912.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377400061; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 71300.8; 0.0; 2.6; 0.06666666666666667; 0.4666666666666667 +1377400362; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377400662; 1; 2599.99931; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377400962; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 130022.4; 0.0; 11.733333333333333; 0.0; 0.0 +1377401262; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377401562; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377401862; 1; 2599.99931; 0.0; 0.0; 2097152.0; 60115.73333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377402162; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377402462; 1; 2599.99931; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377402762; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1377403062; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377403362; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377403662; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 148197.33333333334; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377403962; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 205519.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377404262; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1377404562; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377404862; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377405162; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377405462; 1; 2599.99931; 0.0; 0.0; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377405762; 1; 2599.99931; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 1.2; 0.0; 0.0 +1377406062; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377406362; 1; 2599.99931; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.0; 0.0; 0.0 +1377406662; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377406962; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377407262; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 83884.0; 0.0; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1377407562; 1; 2599.99931; 0.0; 0.0; 2097152.0; 142604.8; 0.06666666666666667; 1.0666666666666667; 0.0; 0.0 +1377407862; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377408162; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377408462; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377408762; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377409062; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377409362; 1; 2599.99931; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377409662; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377409962; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.2; 0.0; 0.0 +1377410262; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377410562; 1; 2599.99931; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377410862; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 159382.4; 0.06666666666666667; 8.533333333333333; 0.26666666666666666; 0.6 +1377411162; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 163576.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377411462; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1377411763; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1377412063; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1377412363; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 96467.2; 0.06666666666666667; 1.4666666666666666; 0.06666666666666667; 0.13333333333333333 +1377412663; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 138410.4; 0.0; 2.066666666666667; 0.0; 0.0 +1377412963; 1; 2599.99931; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.4666666666666666; 0.0; 0.0 +1377413263; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1377413563; 1; 2599.99931; 0.0; 0.0; 2097152.0; 61513.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377413863; 1; 2599.99931; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377414163; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377414463; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 142604.8; 0.06666666666666667; 2.2666666666666666; 0.0; 0.4666666666666667 +1377414763; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 176158.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377415063; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377415363; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377415663; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377415963; 1; 2599.99931; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377416263; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377416563; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.2; 0.0; 0.0 +1377416863; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1377417163; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377417463; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 82485.86666666667; 0.0; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1377417763; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377418063; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 90874.66666666667; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377418363; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 138410.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377418663; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377418963; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104855.2; 0.0; 0.8; 0.0; 0.0 +1377419263; 1; 2599.99931; 0.0; 0.0; 2097152.0; 64310.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377419564; 1; 2599.99931; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377419864; 1; 2599.99931; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377420164; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377420464; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377420764; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1377421064; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377421364; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377421664; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 125827.2; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377421964; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 205519.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377422264; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377422564; 1; 2599.99931; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.8; 0.0; 0.0 +1377422864; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377423164; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1377423464; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377424064; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377424364; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.6; 0.0; 0.0 +1377424663; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377424963; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377425263; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 109050.4; 0.06666666666666667; 2.933333333333333; 0.0; 0.4666666666666667 +1377425563; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 130021.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377425863; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377426163; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377426463; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1377426763; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377427063; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377427363; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377427663; 1; 2599.99931; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377427963; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377428263; 1; 2599.99931; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377428563; 1; 2599.99931; 0.0; 0.0; 2097152.0; 64310.13333333333; 0.0; 0.8; 0.0; 0.0 +1377428863; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 81087.73333333334; 0.06666666666666667; 2.2; 0.06666666666666667; 0.4666666666666667 +1377429163; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377429463; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377429763; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377430063; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377430363; 1; 2599.99931; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377430664; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1377430964; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 130021.6; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377431264; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.2; 0.0; 0.0 +1377431564; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377431864; 1; 2599.99931; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377432164; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.2; 0.0; 0.0 +1377432464; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 118837.33333333333; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377432764; 1; 2599.99931; 0.0; 0.0; 2097152.0; 144002.93333333332; 0.0; 0.6666666666666666; 0.0; 0.0 +1377433064; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 156585.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377433364; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377433664; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377433964; 1; 2599.99931; 0.0; 0.0; 2097152.0; 166372.26666666666; 0.0; 0.8; 0.0; 0.0 +1377434264; 1; 2599.99931; 0.0; 0.0; 2097152.0; 125826.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377434564; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1377434864; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377435164; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8; 0.0; 0.0 +1377435464; 1; 2599.99931; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377435764; 1; 2599.99931; 0.0; 0.0; 2097152.0; 146800.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377436064; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 117439.2; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377436364; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 195731.46666666667; 0.0; 1.2; 0.0; 0.0 +1377436664; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 124429.6; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377436964; 1; 2599.99931; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377437264; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 118837.33333333333; 0.06666666666666667; 7.133333333333334; 0.2; 0.13333333333333333 +1377437564; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377437864; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1377438164; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1377438464; 1; 2599.99931; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1377438764; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.5333333333333333; 0.0; 0.0 +1377439064; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377439364; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377439664; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 138411.2; 0.06666666666666667; 2.3333333333333335; 0.0; 0.4666666666666667 +1377439964; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 157984.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377440264; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377440564; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377440864; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377441164; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 135614.93333333332; 0.0; 1.0; 0.06666666666666667; 0.06666666666666667 +1377441464; 1; 2599.99931; 0.0; 0.0; 2097152.0; 146798.4; 0.0; 0.8; 0.0; 0.0 +1377441764; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1377442064; 1; 2599.99931; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377442364; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.6; 0.0; 0.0 +1377442665; 1; 2599.99931; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.5333333333333333; 0.0; 0.0 +1377442965; 1; 2599.99931; 0.0; 0.0; 2097152.0; 150993.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377443265; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 118837.33333333333; 0.06666666666666667; 2.466666666666667; 0.0; 0.4666666666666667 +1377443565; 1; 2599.99931; 0.0; 0.0; 2097152.0; 150993.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377443865; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 123031.73333333334; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377444165; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.5333333333333333; 0.0; 0.0 +1377444465; 1; 2599.99931; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0; 0.0; 0.0 +1377444765; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 93670.93333333333; 0.0; 11.533333333333333; 0.0; 0.0 +1377445065; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377445365; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377445665; 1; 2599.99931; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377445965; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377446265; 1; 2599.99931; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377446565; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.06666666666666667; 1.1333333333333333; 0.0; 0.0 +1377446865; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 144002.4; 0.0; 1.9333333333333333; 0.0; 0.4666666666666667 +1377447165; 1; 2599.99931; 62.39998344000001; 2.4; 2097152.0; 454381.6; 161.0; 21.733333333333334; 0.0; 0.4 +1377447465; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 671087.2; 0.0; 2.533333333333333; 0.0; 0.0 +1377447765; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 264238.93333333335; 31.8; 3.3333333333333335; 0.0; 0.0 +1377448065; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 150993.33333333334; 0.0; 2.2666666666666666; 0.0; 0.0 +1377448365; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 139808.53333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1377448665; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1377448965; 1; 2599.99931; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.6; 0.0; 0.0 +1377449265; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 159382.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377449565; 1; 2599.99931; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.6; 0.0; 0.0 +1377449865; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377450165; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 130021.86666666667; 12.733333333333333; 13.333333333333334; 0.3333333333333333; 0.13333333333333333 +1377450465; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 233481.06666666668; 0.06666666666666667; 2.4; 0.0; 0.4666666666666667 +1377450765; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 194334.66666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1377451065; 1; 2599.99931; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377451365; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1377451665; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377451965; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377452265; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377452566; 1; 2599.99931; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377452866; 1; 2599.99931; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 1.2; 0.0; 0.0 +1377453166; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1377453466; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377453766; 1; 2599.99931; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377454066; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 114642.4; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1377454366; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 171964.53333333333; 0.0; 0.8; 0.0; 0.0 +1377454666; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377454966; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377455266; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377455566; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1377455866; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377456166; 1; 2599.99931; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377456466; 1; 2599.99931; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377456766; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1377457066; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 141207.46666666667; 0.0; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1377457366; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377457666; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 142604.8; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377457966; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 174760.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377458266; 1; 2599.99931; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377458566; 1; 2599.99931; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377458866; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377459166; 1; 2599.99931; 36.39999034; 1.4; 2097152.0; 297793.6; 161.0; 14.333333333333334; 0.0; 0.13333333333333333 +1377459466; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 466963.2; 0.0; 1.0; 0.0; 0.0 +1377459766; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 211110.66666666666; 31.8; 3.8; 0.0; 0.0 +1377460066; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 169169.06666666668; 0.0; 1.0; 0.0; 0.0 +1377460366; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377460666; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377460966; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.6; 0.0; 0.0 +1377461266; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 120234.66666666667; 0.06666666666666667; 2.533333333333333; 0.0; 0.4666666666666667 +1377461566; 1; 2599.99931; 0.0; 0.0; 2097152.0; 173362.4; 0.0; 0.8; 0.0; 0.0 +1377461866; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 134216.8; 0.0; 0.5333333333333333; 0.0; 0.0 +1377462166; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.5333333333333333; 0.0; 0.0 +1377462466; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 76893.33333333333; 0.06666666666666667; 7.2; 0.2; 0.13333333333333333 +1377462766; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1377463066; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377463366; 1; 2599.99931; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377463666; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.6; 0.0; 0.0 +1377463966; 1; 2599.99931; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.0; 0.0 +1377464266; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377464566; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 127226.13333333333; 0.0; 0.6; 0.0; 0.0 +1377464866; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 99263.46666666666; 0.0; 2.2; 0.0; 0.4666666666666667 +1377465167; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 1.0; 0.0; 0.0 +1377465467; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377465767; 1; 2599.99931; 0.0; 0.0; 2097152.0; 65708.26666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1377466067; 1; 2599.99931; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.6; 0.0; 0.0 +1377466367; 1; 2599.99931; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1377466667; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377466967; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377467267; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 104855.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377467567; 1; 2599.99931; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377467867; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377468167; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377468467; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 118837.33333333333; 0.0; 2.1333333333333333; 0.0; 0.4666666666666667 +1377468767; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 144002.13333333333; 0.0; 0.6; 0.0; 0.0 +1377469067; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1377469367; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 137013.06666666668; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1377469667; 1; 2599.99931; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377469967; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 113244.8; 0.0; 1.4; 0.06666666666666667; 0.06666666666666667 +1377470267; 1; 2599.99931; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 0.6; 0.0; 0.0 +1377470567; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1377470867; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1377471167; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377471467; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1377471767; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377472067; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 128624.26666666666; 0.2; 2.8; 0.0; 0.4666666666666667 +1377472367; 1; 2599.99931; 0.0; 0.0; 2097152.0; 148197.33333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377472667; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377472967; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377473267; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377473567; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1377473867; 1; 2599.99931; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377474167; 1; 2599.99931; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 1.0; 0.0; 0.0 +1377474467; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.0; 0.0 +1377474767; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 100661.6; 0.06666666666666667; 6.933333333333334; 0.2; 0.13333333333333333 +1377475067; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377475367; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377475667; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 96466.93333333333; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377475967; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 176158.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377476267; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 116041.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377476567; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377476867; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377477168; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 1.3333333333333333; 0.0; 0.0 +1377477468; 1; 2599.99931; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377477768; 1; 2599.99931; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377478068; 1; 2599.99931; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377478368; 1; 2599.99931; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377478668; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377478968; 1; 2599.99931; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377479268; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 117439.2; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1377479568; 1; 2599.99931; 0.0; 0.0; 2097152.0; 155188.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377479868; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377480168; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377480468; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377480768; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 7.066666666666666; 0.2; 0.13333333333333333 +1377481068; 1; 2599.99931; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377481368; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377481668; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377481968; 1; 2599.99931; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377482268; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377482568; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377482868; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 93670.93333333333; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1377483168; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 145401.86666666667; 0.0; 1.0; 0.0; 0.0 +1377483468; 1; 2599.99931; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377483768; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377484068; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377484368; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377484668; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1377484968; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377485268; 1; 2599.99931; 0.0; 0.0; 2097152.0; 124429.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377485568; 1; 2599.99931; 0.0; 0.0; 2097152.0; 160780.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377485868; 1; 2599.99931; 0.0; 0.0; 2097152.0; 124429.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377486168; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 85282.13333333333; 0.06666666666666667; 7.2; 0.26666666666666666; 0.13333333333333333 +1377486468; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 99263.46666666666; 0.06666666666666667; 2.2; 0.0; 0.4666666666666667 +1377486768; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 190139.73333333334; 0.0; 0.8; 0.0; 0.0 +1377487068; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377487368; 1; 2599.99931; 0.0; 0.0; 2097152.0; 111845.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377487668; 1; 2599.99931; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377487968; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377488269; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 11.733333333333333; 0.0; 0.0 +1377488569; 1; 2599.99931; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377488869; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1377489169; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377489469; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377489769; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.6666666666666667; 0.0; 0.0 +1377490068; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 118837.33333333333; 0.0; 2.6; 0.06666666666666667; 0.4666666666666667 +1377490368; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 180353.6; 0.0; 1.0; 0.0; 0.0 +1377490668; 1; 2599.99931; 0.0; 0.0; 2097152.0; 142604.8; 0.0; 0.8; 0.0; 0.0 +1377490968; 1; 2599.99931; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377491268; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1377491568; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377491868; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377492168; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377492468; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 1.0; 0.0; 0.0 +1377492768; 1; 2599.99931; 0.0; 0.0; 2097152.0; 142604.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377493068; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 109050.4; 0.0; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1377493368; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1377493668; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 106254.13333333333; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1377493968; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 176157.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377494268; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 155187.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377494569; 1; 2599.99931; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377494869; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377495169; 1; 2599.99931; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377495469; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377495769; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1377496069; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377496369; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377496669; 1; 2599.99931; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377496969; 1; 2599.99931; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1377497269; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 107651.46666666666; 0.06666666666666667; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1377497569; 1; 2599.99931; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377497869; 1; 2599.99931; 0.0; 0.0; 2097152.0; 139809.33333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377498169; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377498469; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377498769; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 61513.86666666667; 0.06666666666666667; 1.1333333333333333; 0.06666666666666667; 0.13333333333333333 +1377499069; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 58717.6; 0.0; 1.8; 0.0; 0.0 +1377499369; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 1.5333333333333334; 0.0; 0.0 +1377499669; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 6.8; 0.2; 0.13333333333333333 +1377499969; 1; 2599.99931; 60.666650566666675; 2.3333333333333335; 2097152.0; 359311.4666666667; 161.0; 21.733333333333334; 0.06666666666666667; 0.4 +1377500269; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 654309.6; 0.0; 2.6; 0.0; 0.0 +1377500569; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 310376.8; 31.8; 3.4; 0.0; 0.0 +1377500869; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 192935.2; 0.0; 3.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1377501169; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 192936.0; 0.0; 1.8666666666666667; 0.0; 0.0 +1377501470; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377501770; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377502070; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377502370; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377502670; 1; 2599.99931; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 1.0; 0.06666666666666667; 0.0 +1377502970; 1; 2599.99931; 36.39999034; 1.4; 2097152.0; 92272.8; 0.0; 1.2; 104.86666666666666; 0.0 +1377503270; 1; 2599.99931; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377503570; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377503870; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 0.8; 0.4; 0.0 +1377504170; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377504470; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 99262.66666666667; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1377504770; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 159381.6; 0.0; 0.8; 0.0; 0.0 +1377505070; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8; 0.06666666666666667; 0.0 +1377505370; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1377505670; 1; 2599.99931; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377505970; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1377506270; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377506570; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 113244.8; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377506870; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377507170; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377507470; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377507770; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.06666666666666667; 0.0 +1377508070; 1; 2599.99931; 13.866662986666668; 0.5333333333333333; 2097152.0; 142605.6; 0.13333333333333333; 2.466666666666667; 0.0; 0.4666666666666667 +1377508370; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 142605.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377508670; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1377508970; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377509270; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377509570; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1377509870; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377510170; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377510470; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377510771; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377511071; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 86680.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377511371; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 152391.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377511671; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.06666666666666667; 2.2666666666666666; 0.13333333333333333; 0.4666666666666667 +1377511971; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 156586.13333333333; 12.733333333333333; 12.933333333333334; 0.4666666666666667; 0.2 +1377512271; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377512571; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1377512871; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377513171; 1; 2599.99931; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377513471; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 1.4; 0.0; 0.0 +1377513771; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377514071; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377515571; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377515871; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 111846.66666666667; 0.0; 0.6; 0.0; 0.0 +1377516171; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 134216.8; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1377516471; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377516771; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 3.1333333333333333; 0.0 +1377517071; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1377517371; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377517671; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377517971; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 85282.13333333333; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377518271; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 0.8; 0.0; 0.0 +1377518571; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.6; 0.0; 0.0 +1377518871; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 106254.13333333333; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1377519171; 1; 2599.99931; 0.0; 0.0; 2097152.0; 169168.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377519472; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377519772; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 95069.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377520072; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377520372; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1377520672; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377520972; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 131420.53333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377521272; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377521572; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 134216.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377521872; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1377522172; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 71300.8; 0.0; 0.6; 0.0; 0.0 +1377522472; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 107652.26666666666; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1377522771; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 204121.06666666668; 0.0; 0.8; 0.0; 0.0 +1377523071; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377523371; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 79689.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377523671; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377523971; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377524271; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 1.6666666666666667; 0.0; 0.0 +1377524571; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 100661.6; 0.0; 7.4; 0.6; 0.2 +1377524871; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377525171; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377525471; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 78291.46666666666; 0.0; 0.8; 0.0; 0.0 +1377525771; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377526071; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 130022.4; 0.0; 2.6; 0.06666666666666667; 0.4666666666666667 +1377526371; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 139808.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377526671; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377526971; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377527271; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377527571; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 102059.73333333334; 0.0; 1.4666666666666666; 0.06666666666666667; 0.13333333333333333 +1377527871; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377528171; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377528472; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377528772; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.5333333333333333; 0.0 +1377529072; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377529372; 1; 2599.99931; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377529672; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 150992.8; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377529972; 1; 2599.99931; 0.0; 0.0; 2097152.0; 171965.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377530272; 1; 2599.99931; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377530572; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 6.6; 0.2; 0.13333333333333333 +1377530872; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377531172; 1; 2599.99931; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377531472; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1377531772; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 150994.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377532072; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 118837.33333333333; 0.0; 12.066666666666666; 0.06666666666666667; 0.0 +1377532372; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 1.8; 0.0 +1377532672; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 2.2666666666666666; 0.0 +1377532972; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377533272; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 121633.6; 0.06666666666666667; 2.6; 0.06666666666666667; 0.4666666666666667 +1377533572; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1377533872; 1; 2599.99931; 0.0; 0.0; 2097152.0; 142604.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377534172; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 4.2; 0.0 +1377534472; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377534772; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377535072; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377535372; 1; 2599.99931; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.0; 0.0 +1377535672; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377535972; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.2; 0.0; 0.0 +1377536272; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377536572; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377536872; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 128623.46666666666; 0.13333333333333333; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377537172; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 155188.0; 0.0; 7.2; 0.2; 0.13333333333333333 +1377537472; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377537772; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377538072; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1377538372; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 2.2666666666666666; 0.0 +1377538672; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377538972; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377539272; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 131420.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377539572; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 137013.06666666668; 0.0; 0.6666666666666666; 0.0; 0.0 +1377539873; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 142604.53333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1377540173; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1377540473; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 142604.8; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1377540773; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 169169.33333333334; 0.0; 0.8; 0.0; 0.0 +1377541073; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377541373; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377541673; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377541973; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 111846.13333333333; 0.0; 0.8; 0.6; 0.0 +1377542273; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.6; 0.0; 0.0 +1377542573; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.8; 3.2; 0.0 +1377542873; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1377543173; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 141207.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377543473; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 173363.2; 0.0; 6.8; 0.2; 0.13333333333333333 +1377543773; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377544073; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 106254.13333333333; 0.0; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1377544373; 1; 2599.99931; 0.0; 0.0; 2097152.0; 156585.33333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377544673; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 125827.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377544973; 1; 2599.99931; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 0.8; 0.0; 0.0 +1377545273; 1; 2599.99931; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1377545573; 1; 2599.99931; 50.26665332666667; 1.9333333333333333; 2097152.0; 233481.6; 161.2; 14.6; 0.06666666666666667; 0.2 +1377545873; 1; 2599.99931; 13.866662986666668; 0.5333333333333333; 2097152.0; 486537.06666666665; 0.0; 1.2666666666666666; 0.0; 0.0 +1377546173; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 208314.66666666666; 31.8; 3.6666666666666665; 0.0; 0.0 +1377546473; 1; 2599.99931; 0.0; 0.0; 2097152.0; 201324.53333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1377546773; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1377547073; 1; 2599.99931; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377547373; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377547673; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 128623.73333333334; 0.0; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1377547973; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 190140.26666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377548273; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377548573; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 1.8666666666666667; 0.0 +1377548873; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 131420.53333333333; 0.0; 7.333333333333333; 0.2; 0.13333333333333333 +1377549173; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1377549473; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377549774; 1; 2599.99931; 0.0; 0.0; 2097152.0; 137013.06666666668; 0.0; 0.9333333333333333; 0.0; 0.0 +1377550074; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377550374; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377550674; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377550974; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377551274; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 132817.6; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377551574; 1; 2599.99931; 60.666650566666675; 2.3333333333333335; 2097152.0; 423622.93333333335; 161.0; 21.6; 0.5333333333333333; 0.4 +1377551874; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 608172.0; 0.0; 2.533333333333333; 0.0; 0.0 +1377552174; 1; 2599.99931; 13.866662986666668; 0.5333333333333333; 2097152.0; 232082.13333333333; 31.8; 3.533333333333333; 0.0; 0.0 +1377552474; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 149595.2; 0.0; 2.533333333333333; 0.0; 0.0 +1377552774; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 116041.06666666667; 0.0; 1.6666666666666667; 0.0; 0.0 +1377553074; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377553374; 1; 2599.99931; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377553674; 1; 2599.99931; 0.0; 0.0; 2097152.0; 124429.33333333333; 0.0; 1.2; 0.0; 0.0 +1377553974; 1; 2599.99931; 0.0; 0.0; 2097152.0; 120235.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377554274; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377554574; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.9333333333333333; 1.5333333333333334; 0.0 +1377554874; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 2.4; 0.0; 0.4666666666666667 +1377555174; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 113244.0; 0.0; 1.2; 0.06666666666666667; 0.0 +1377555474; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377555774; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 99263.46666666666; 0.0; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1377556074; 1; 2599.99931; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377556374; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 149595.46666666667; 0.06666666666666667; 1.8; 0.13333333333333333; 0.06666666666666667 +1377556674; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377556974; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1377557274; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377557574; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377557874; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 1.9333333333333333; 0.0; 0.0 +1377558174; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377558474; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 106253.6; 0.06666666666666667; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377558774; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 157984.0; 0.0; 0.8; 0.0; 0.0 +1377559074; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1377559374; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377559674; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377559974; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377560274; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377560574; 1; 2599.99931; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377560874; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1377561174; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377561474; 1; 2599.99931; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377561774; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 6.933333333333334; 0.26666666666666666; 0.13333333333333333 +1377562074; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 128623.73333333334; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1377562374; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 148197.06666666668; 0.0; 0.7333333333333333; 0.0; 0.0 +1377562674; 1; 2599.99931; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377562974; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377563274; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377563574; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 95069.06666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1377563874; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377564174; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377564474; 1; 2599.99931; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377564774; 1; 2599.99931; 0.0; 0.0; 2097152.0; 67106.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377565074; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377565374; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377565674; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 123031.2; 0.06666666666666667; 2.0; 0.06666666666666667; 0.4666666666666667 +1377565974; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 177557.06666666668; 0.0; 0.9333333333333333; 0.0; 0.0 +1377566274; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377566574; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377566874; 1; 2599.99931; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377567175; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 110448.53333333334; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1377567475; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377567775; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377568075; 1; 2599.99931; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377568375; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377568675; 1; 2599.99931; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377568975; 1; 2599.99931; 0.0; 0.0; 2097152.0; 148198.13333333333; 0.0; 1.2; 0.0; 0.0 +1377569275; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 102059.73333333334; 0.2; 2.066666666666667; 0.0; 0.4666666666666667 +1377569575; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 164974.93333333332; 0.0; 0.7333333333333333; 0.0; 0.0 +1377569875; 1; 2599.99931; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1377570175; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1377570475; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377570775; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377571075; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377571375; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 113244.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377571675; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 96466.93333333333; 0.0; 1.0; 0.0; 0.0 +1377571975; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 76893.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377572275; 1; 2599.99931; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1377572575; 1; 2599.99931; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1377572875; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 162177.86666666667; 12.8; 14.466666666666667; 0.4; 0.6 +1377573175; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 152391.73333333334; 0.0; 1.4; 0.0; 0.0 +1377573475; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377573776; 1; 2599.99931; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377574076; 1; 2599.99931; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377574376; 1; 2599.99931; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377574676; 1; 2599.99931; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377574976; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377575276; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377575576; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 128624.26666666666; 0.0; 11.8; 0.0; 0.0 +1377575876; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1377576176; 1; 2599.99931; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.06666666666666667; 0.0 +1377576476; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 102058.66666666667; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377576776; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 170566.93333333332; 0.0; 0.7333333333333333; 0.0; 0.0 +1377577076; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 137013.06666666668; 0.0; 0.8; 0.0; 0.0 +1377577376; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1377577676; 1; 2599.99931; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377577976; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377578276; 1; 2599.99931; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377578576; 1; 2599.99931; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377578876; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 97865.33333333333; 0.0; 7.066666666666666; 0.4; 0.13333333333333333 +1377579176; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 148196.53333333333; 0.0; 0.8; 0.0; 0.0 +1377579476; 1; 2599.99931; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377579776; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377580076; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 113243.73333333334; 0.06666666666666667; 2.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1377580376; 1; 2599.99931; 0.0; 0.0; 2097152.0; 198528.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377580676; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377580976; 1; 2599.99931; 0.0; 0.0; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377581276; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377581576; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377581876; 1; 2599.99931; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377582176; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377582476; 1; 2599.99931; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377582776; 1; 2599.99931; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1377583077; 1; 2599.99931; 0.0; 0.0; 2097152.0; 107651.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377583377; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 65708.26666666666; 0.06666666666666667; 1.2; 0.0; 0.0 +1377583677; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 92272.8; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1377583977; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377584277; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377584577; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377584877; 1; 2599.99931; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.2; 0.0 +1377585177; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.8666666666666667; 0.26666666666666666; 0.06666666666666667 +1377585477; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 145401.06666666668; 0.0; 1.5333333333333334; 0.0; 0.0 +1377585777; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1377586077; 1; 2599.99931; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377586377; 1; 2599.99931; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377586677; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.6; 0.06666666666666667; 0.0 +1377586977; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377587277; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 107652.0; 0.0; 2.2; 0.2; 0.4666666666666667 +1377587577; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 170566.13333333333; 0.0; 0.6; 0.26666666666666666; 0.0 +1377587877; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 137013.06666666668; 0.0; 0.6; 0.0; 0.0 +1377588177; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 159382.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377588477; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 132818.13333333333; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1377588776; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 148198.13333333333; 0.0; 0.6; 0.13333333333333333; 0.0 +1377589076; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 132818.66666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377589376; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1377589676; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 90874.66666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1377589976; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 0.6; 5.2; 0.0 +1377590277; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 118837.33333333333; 0.0; 6.733333333333333; 0.26666666666666666; 0.13333333333333333 +1377590577; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1377590877; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 113244.8; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377591177; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 181751.73333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1377591477; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 123031.73333333334; 0.0; 0.6; 0.13333333333333333; 0.0 +1377591777; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377592077; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 135614.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1377592377; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1377592677; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377592977; 1; 2599.99931; 0.0; 0.0; 2097152.0; 149595.46666666667; 0.0; 0.6; 0.0; 0.0 +1377593277; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 131420.53333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1377593577; 1; 2599.99931; 0.0; 0.0; 2097152.0; 128623.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377593877; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377594177; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 137013.06666666668; 0.0; 0.5333333333333333; 0.06666666666666667; 0.0 +1377594477; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 93670.93333333333; 0.2; 2.066666666666667; 0.13333333333333333; 0.4666666666666667 +1377594777; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 0.6; 0.5333333333333333; 0.0 +1377595077; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 107652.26666666666; 0.0; 0.6; 9.4; 0.0 +1377595377; 1; 2599.99931; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377595677; 1; 2599.99931; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377595977; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377596277; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 106254.13333333333; 0.0; 6.8; 0.3333333333333333; 0.13333333333333333 +1377596577; 1; 2599.99931; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377596877; 1; 2599.99931; 0.0; 0.0; 2097152.0; 132817.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377597177; 1; 2599.99931; 0.0; 0.0; 2097152.0; 132817.86666666667; 0.0; 0.8; 0.0; 0.0 +1377597477; 1; 2599.99931; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377597777; 1; 2599.99931; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1377598077; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 109050.4; 0.0; 2.4; 0.0; 0.5333333333333333 +1377598377; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 137012.26666666666; 0.06666666666666667; 0.9333333333333333; 1.2666666666666666; 0.0 +1377598677; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.6; 0.0; 0.0 +1377598977; 1; 2599.99931; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.6; 0.0; 0.0 +1377599277; 1; 2599.99931; 64.13331631333334; 2.466666666666667; 2097152.0; 603977.0666666667; 161.0; 22.8; 0.0; 0.4 +1377599577; 1; 2599.99931; 12.133330113333335; 0.4666666666666666; 2097152.0; 394262.4; 0.0; 4.8; 0.0; 0.0 +1377599877; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 190140.0; 31.8; 3.533333333333333; 0.0; 0.0 +1377600177; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 156586.13333333333; 0.0; 2.3333333333333335; 0.06666666666666667; 0.0 +1377600477; 1; 2599.99931; 6.933331493333334; 0.26666666666666666; 2097152.0; 118837.33333333333; 0.0; 1.5333333333333334; 0.0; 0.0 +1377600777; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377601077; 1; 2599.99931; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377601377; 1; 2599.99931; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377601677; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 96467.2; 0.06666666666666667; 2.0; 0.0; 0.4666666666666667 +1377601977; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 141207.46666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377602278; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 113244.8; 0.0; 1.8666666666666667; 0.0; 0.0 +1377602578; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377602878; 1; 2599.99931; 8.66666436666667; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1377603178; 1; 2599.99931; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377603478; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377603778; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377604078; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.06666666666666667; 0.0 +1377604378; 1; 2599.99931; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 1.1333333333333333; 0.0 +1377604678; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 121632.8; 0.0; 0.8666666666666667; 2.6666666666666665; 0.0 +1377604978; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377605278; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 121632.8; 0.06666666666666667; 2.6; 0.0; 0.4666666666666667 +1377605578; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 187343.46666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1377605878; 1; 2599.99931; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377606178; 1; 2599.99931; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377606478; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377606778; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377607078; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377607378; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377607678; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 74097.06666666667; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1377607978; 1; 2599.99931; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377608278; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.7333333333333333; 0.0 +1377608578; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377608878; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 138410.4; 0.06666666666666667; 2.2666666666666666; 80.73333333333333; 0.4666666666666667 +1377609178; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 170566.66666666666; 0.0; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1377609478; 1; 2599.99931; 5.19999862; 0.2; 2097152.0; 138410.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377609778; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377610078; 1; 2599.99931; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377610378; 1; 2599.99931; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1377610678; 1; 2599.99931; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377610978; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377611278; 1; 2599.99931; 1.7333328733333335; 0.06666666666666667; 2097152.0; 139809.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377611578; 1; 2599.99931; 3.466665746666667; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377611878; 1; 2599.99931; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377612178; 1; 2599.99931; 10.39999724; 0.4; 2097152.0; 142604.8; 0.0; 0.8; 10.6; 0.0 +1377612478; 1; 2599.998991; 40.44442874888888; 1.5555555555555554; 2097152.0; 130486.66666666667; 0.0; 3.875; 0.125; 0.875 +1377612778; 1; 2599.998991; 19.066659267333332; 0.7333333333333333; 2097152.0; 201324.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377613078; 1; 2599.998991; 17.33332660666667; 0.6666666666666667; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377613378; 1; 2599.999334; 25.99999334; 1.0; 2097152.0; 83884.0; 0.0; 1.0; 0.0; 0.0 +1377613678; 1; 2599.999334; 10.399997336000002; 0.4; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377613978; 1; 2599.999334; 17.333328893333338; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 1.0; 0.13333333333333333; 0.13333333333333333 +1377614279; 1; 2599.999334; 8.666664446666669; 0.33333333333333337; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377614579; 1; 2599.999334; 3.4666657786666666; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.2; 0.0; 0.0 +1377614879; 1; 2599.999602; 34.666661360000006; 1.3333333333333335; 2097152.0; 83884.0; 0.0; 1.0; 0.0; 0.0 +1377615179; 1; 2599.999602; 17.333330680000003; 0.6666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377615479; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377615779; 1; 2599.999602; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1377616079; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 150993.6; 0.06666666666666667; 2.8; 0.06666666666666667; 0.4666666666666667 +1377616379; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 184547.2; 0.0; 1.0; 0.06666666666666667; 0.0 +1377616679; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377616979; 1; 2599.999602; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377617279; 1; 2599.999602; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377617579; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377617879; 1; 2599.999602; 0.0; 0.0; 2097152.0; 125827.2; 0.0; 0.8; 0.06666666666666667; 0.0 +1377618179; 1; 2599.999602; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377618479; 1; 2599.999602; 0.0; 0.0; 2097152.0; 67106.4; 0.0; 1.2; 0.0; 0.0 +1377618779; 1; 2599.999602; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377619079; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377619379; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 11.733333333333333; 0.0; 0.0 +1377619679; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 99263.46666666666; 0.06666666666666667; 2.4; 0.0; 0.4666666666666667 +1377619979; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 153789.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377620279; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377620579; 1; 2599.999602; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377620879; 1; 2599.999602; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377621179; 1; 2599.999602; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377621479; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 90874.66666666667; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1377621779; 1; 2599.999602; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377622079; 1; 2599.999602; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377622379; 1; 2599.999602; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377622679; 1; 2599.999602; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377622979; 1; 2599.999602; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377623279; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 121633.6; 0.0; 2.1333333333333333; 0.0; 0.4666666666666667 +1377623579; 1; 2599.999602; 0.0; 0.0; 2097152.0; 171964.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377623879; 1; 2599.999602; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377624179; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.26666666666666666; 0.0 +1377624479; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377624779; 1; 2599.999602; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377625079; 1; 2599.999602; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377625379; 1; 2599.999602; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377625679; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 150994.4; 0.0; 0.9333333333333333; 0.6; 0.0 +1377625979; 1; 2599.999602; 0.0; 0.0; 2097152.0; 142605.6; 0.0; 0.8; 0.0; 0.0 +1377626279; 1; 2599.999602; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377626579; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377626879; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1377627179; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 138411.2; 0.0; 1.0; 0.0; 0.0 +1377627479; 1; 2599.999602; 0.0; 0.0; 2097152.0; 159381.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377627779; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 113244.8; 0.0; 7.266666666666667; 0.26666666666666666; 0.2 +1377628079; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 116041.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377628379; 1; 2599.999602; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377628679; 1; 2599.999602; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377628979; 1; 2599.999602; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1377629279; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 67106.4; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377629580; 1; 2599.999602; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377629880; 1; 2599.999602; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1377630180; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377630480; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 137012.26666666666; 0.06666666666666667; 2.2666666666666666; 0.0; 0.4666666666666667 +1377630780; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377631080; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377631380; 1; 2599.999602; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377631680; 1; 2599.999602; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377631980; 1; 2599.999602; 39.866660564; 1.5333333333333334; 2097152.0; 181751.73333333334; 161.06666666666666; 14.266666666666667; 0.13333333333333333; 0.2 +1377632280; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 536869.6; 0.0; 1.2; 0.0; 0.0 +1377632580; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 184548.0; 31.8; 3.8; 0.0; 0.0 +1377632880; 1; 2599.999602; 0.0; 0.0; 2097152.0; 213908.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377633180; 1; 2599.999602; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.0; 0.0; 0.0 +1377633480; 1; 2599.999602; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377633780; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377634080; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 131419.46666666667; 0.06666666666666667; 2.933333333333333; 0.0; 0.5333333333333333 +1377634380; 1; 2599.999602; 0.0; 0.0; 2097152.0; 176159.2; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377634680; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 171964.0; 12.733333333333333; 13.066666666666666; 0.3333333333333333; 0.13333333333333333 +1377634980; 1; 2599.999602; 0.0; 0.0; 2097152.0; 142604.8; 0.0; 1.0; 0.0; 0.0 +1377635280; 1; 2599.999602; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.06666666666666667; 0.0 +1377635580; 1; 2599.999602; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377635880; 1; 2599.999602; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377636180; 1; 2599.999602; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377636480; 1; 2599.999602; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377636780; 1; 2599.999602; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377637080; 1; 2599.999602; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377637380; 1; 2599.999602; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377637680; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 123031.73333333334; 0.06666666666666667; 2.3333333333333335; 0.13333333333333333; 0.4666666666666667 +1377637980; 1; 2599.999602; 0.0; 0.0; 2097152.0; 146798.4; 0.0; 1.0; 0.0; 0.0 +1377638280; 1; 2599.999602; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377638581; 1; 2599.999602; 0.0; 0.0; 2097152.0; 159382.4; 0.0; 0.8; 0.0; 0.0 +1377638881; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377639181; 1; 2599.999602; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377639481; 1; 2599.999602; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377639781; 1; 2599.999602; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377640081; 1; 2599.999602; 0.0; 0.0; 2097152.0; 121632.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377640381; 1; 2599.999602; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 1.0; 0.0; 0.0 +1377640681; 1; 2599.999602; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377640981; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 81087.73333333334; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1377641281; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 131420.53333333333; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377641581; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 171963.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377641881; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377642181; 1; 2599.999602; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1377642481; 1; 2599.999602; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1377642781; 1; 2599.999602; 10.399998407999998; 0.4; 2097152.0; 109050.4; 0.06666666666666667; 1.4666666666666666; 0.06666666666666667; 0.13333333333333333 +1377643081; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377643381; 1; 2599.999602; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377643681; 1; 2599.999602; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377643981; 1; 2599.999602; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1377644281; 1; 2599.999602; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377644581; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377644881; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1377645181; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 152392.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377645481; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 137013.06666666668; 0.0; 0.8; 0.0; 0.0 +1377645781; 1; 2599.999602; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377646081; 1; 2599.999602; 0.0; 0.0; 2097152.0; 60115.73333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377646381; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 128623.46666666666; 0.0; 1.0; 0.0; 0.0 +1377646681; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377646981; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 85282.13333333333; 0.0; 7.733333333333333; 0.2; 0.13333333333333333 +1377647281; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 1.0; 0.06666666666666667; 0.0 +1377647581; 1; 2599.999602; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377647881; 1; 2599.999602; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377648181; 1; 2599.999602; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1377648481; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 102059.73333333334; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1377648781; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 160779.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377649081; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 1.1333333333333333; 0.0 +1377649381; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377649681; 1; 2599.999602; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1377649982; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.2; 0.13333333333333333; 0.0 +1377650282; 1; 2599.999602; 60.66665738; 2.3333333333333335; 2097152.0; 592792.2666666667; 161.06666666666666; 21.8; 0.06666666666666667; 0.4 +1377650582; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 596986.9333333333; 0.0; 2.8666666666666667; 0.06666666666666667; 0.0 +1377650882; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 241868.8; 31.8; 3.533333333333333; 0.13333333333333333; 0.0 +1377651182; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 171964.53333333333; 0.0; 2.2666666666666666; 0.06666666666666667; 0.0 +1377651482; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 137013.06666666668; 0.0; 1.4666666666666666; 0.0; 0.0 +1377651782; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 95069.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377652082; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 82485.33333333333; 0.06666666666666667; 2.6; 0.0; 0.4666666666666667 +1377652382; 1; 2599.999602; 0.0; 0.0; 2097152.0; 137012.53333333333; 0.0; 0.8; 0.0; 0.0 +1377652682; 1; 2599.999602; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377652982; 1; 2599.999602; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6; 0.0; 0.0 +1377653282; 1; 2599.999602; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377653582; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 121633.06666666667; 0.06666666666666667; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1377653882; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 100661.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377654182; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 83884.0; 0.0; 0.6666666666666666; 0.2; 0.0 +1377654482; 1; 2599.999602; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.8; 0.0; 0.0 +1377654782; 1; 2599.999602; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377655082; 1; 2599.999602; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.5333333333333333; 0.0; 0.0 +1377655382; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1377655682; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 145401.33333333334; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377655982; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 144003.46666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1377656282; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377656582; 1; 2599.999602; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.6; 0.0; 0.0 +1377656882; 1; 2599.999602; 0.0; 0.0; 2097152.0; 159381.6; 0.0; 0.6; 0.0; 0.0 +1377657182; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1377657482; 1; 2599.999602; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377657782; 1; 2599.999602; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6; 0.0; 0.0 +1377658082; 1; 2599.999602; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377658382; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377658682; 1; 2599.999602; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377658982; 1; 2599.999602; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1377659282; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377659582; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 135614.13333333333; 0.0; 1.0; 0.0; 0.0 +1377659882; 1; 2599.999602; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.6; 0.0; 0.0 +1377660182; 1; 2599.999602; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377660482; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 135614.93333333332; 0.0; 6.733333333333333; 0.26666666666666666; 0.2 +1377660782; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 152391.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377661082; 1; 2599.999602; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377661382; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1377661682; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 1.2; 0.0; 0.0 +1377661982; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.6; 3.8666666666666667; 0.0 +1377662282; 1; 2599.999602; 6.933332272; 0.26666666666666666; 2097152.0; 125828.0; 0.06666666666666667; 1.6666666666666667; 0.06666666666666667; 0.0 +1377662582; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 120235.46666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1377662882; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 116040.0; 0.13333333333333333; 13.133333333333333; 0.06666666666666667; 0.4666666666666667 +1377663182; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 166372.0; 0.0; 0.8; 0.0; 0.0 +1377663482; 1; 2599.999602; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.6; 1.0; 0.0 +1377663782; 1; 2599.999602; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.6; 0.0; 0.0 +1377664082; 1; 2599.999602; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377664382; 1; 2599.999602; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377664683; 1; 2599.999602; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.06666666666666667; 0.0 +1377664983; 1; 2599.999602; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377665283; 1; 2599.999602; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377665583; 1; 2599.999602; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377665883; 1; 2599.999602; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377666183; 1; 2599.999602; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377666483; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 127225.06666666667; 0.06666666666666667; 2.3333333333333335; 0.0; 0.4666666666666667 +1377666783; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 209713.33333333334; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1377667083; 1; 2599.999602; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377667383; 1; 2599.999602; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377667683; 1; 2599.999602; 1.733333068; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377667983; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377668283; 1; 2599.999602; 0.0; 0.0; 2097152.0; 114642.13333333333; 0.0; 0.9333333333333333; 0.8666666666666667; 0.0 +1377668583; 1; 2599.999602; 0.0; 0.0; 2097152.0; 109049.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377668883; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.0; 0.7333333333333333; 0.0 +1377669183; 1; 2599.999602; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377669483; 1; 2599.999602; 0.0; 0.0; 2097152.0; 64310.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377669783; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.3333333333333333; 0.0 +1377670083; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 81087.73333333334; 0.0; 2.7333333333333334; 0.0; 0.4666666666666667 +1377670383; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 155188.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377670683; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 120234.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377670983; 1; 2599.999602; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377671283; 1; 2599.999602; 3.466666136; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.2; 0.0 +1377671583; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 85282.13333333333; 0.0; 2.1333333333333333; 0.13333333333333333; 0.13333333333333333 +1377671883; 1; 2599.999602; 13.866664544; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.5333333333333334; 0.3333333333333333; 0.0 +1377672183; 1; 2599.999602; 8.666665340000002; 0.33333333333333337; 2097152.0; 137013.06666666668; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377672483; 1; 2599.999602; 0.0; 0.0; 2097152.0; 142604.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377672783; 1; 2599.9993; 25.999993; 1.0; 2097152.0; 62912.0; 0.0; 1.125; 0.0; 0.0 +1377673083; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377673383; 1; 2599.9993; 12.133330066666666; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 7.0; 0.26666666666666666; 0.2 +1377673683; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 123030.93333333333; 0.0; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1377673983; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377674283; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377674583; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377674883; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377675183; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377675483; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 1.2; 0.06666666666666667; 0.0 +1377675783; 1; 2599.9993; 0.0; 0.0; 2097152.0; 61513.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377676083; 1; 2599.9993; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 1.2; 0.06666666666666667; 0.0 +1377676383; 1; 2599.9993; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377676684; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377676984; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 148197.33333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377677284; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 135614.13333333333; 0.2; 2.4; 0.0; 0.5333333333333333 +1377677584; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377677884; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377678184; 1; 2599.9993; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1377678484; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117438.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377678784; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377679084; 1; 2599.9993; 10.3999972; 0.4; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1377679384; 1; 2599.9993; 17.33332866666667; 0.6666666666666667; 2097152.0; 74097.06666666667; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1377679684; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 150993.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377679984; 1; 2599.9993; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377680284; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377680584; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377680884; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 120234.66666666667; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1377681184; 1; 2599.9993; 10.3999972; 0.4; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377681484; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377681784; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377682084; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377682384; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377682684; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.6; 0.0; 0.0 +1377682984; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 123030.66666666667; 0.0; 1.8666666666666667; 0.0; 0.06666666666666667 +1377683284; 1; 2599.9993; 24.266660133333332; 0.9333333333333332; 2097152.0; 184548.0; 0.0; 3.6666666666666665; 0.0; 0.0 +1377683584; 1; 2599.9993; 13.866662933333332; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 2.8666666666666667; 0.0; 0.0 +1377683884; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 1.2; 0.0; 0.0 +1377684184; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377684484; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377684784; 1; 2599.9993; 13.866662933333332; 0.5333333333333333; 2097152.0; 153789.86666666667; 0.0; 7.0; 0.2; 0.13333333333333333 +1377685084; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 150993.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377685384; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377685684; 1; 2599.9993; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377685984; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377686284; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.06666666666666667; 0.0 +1377686584; 1; 2599.9993; 0.0; 0.0; 2097152.0; 142605.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377686884; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 142604.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377687184; 1; 2599.9993; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377687484; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377687784; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377688084; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 100661.6; 0.06666666666666667; 2.6; 0.06666666666666667; 0.4666666666666667 +1377688384; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 167770.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377688684; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377688984; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377689284; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377689584; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377689884; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377690184; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377690484; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1377690784; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 157983.46666666667; 0.06666666666666667; 7.2; 0.2; 0.13333333333333333 +1377691084; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 130020.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377691384; 1; 2599.9993; 0.0; 0.0; 2097152.0; 128623.46666666666; 0.0; 1.5333333333333334; 0.0; 0.0 +1377691684; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 109050.4; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377691984; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 127226.13333333333; 0.06666666666666667; 1.1333333333333333; 0.0; 0.0 +1377692284; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377692584; 1; 2599.9993; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377692884; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1377693184; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377693484; 1; 2599.9993; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1377693784; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377694084; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377694384; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377694684; 1; 2599.9993; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377694984; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1377695284; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 120234.93333333333; 0.06666666666666667; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377695584; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 170567.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377695884; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.13333333333333333; 0.0 +1377696184; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377696484; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.2; 0.0 +1377696785; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1377697085; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 124429.06666666667; 12.933333333333334; 13.133333333333333; 0.4666666666666667; 0.13333333333333333 +1377697385; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.06666666666666667; 0.0 +1377697685; 1; 2599.9993; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1377697985; 1; 2599.9993; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377698285; 1; 2599.9993; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377698585; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377698885; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 121633.6; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.5333333333333333 +1377699185; 1; 2599.9993; 0.0; 0.0; 2097152.0; 155188.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377699485; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.8; 0.0; 0.0 +1377699785; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377700085; 1; 2599.9993; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377700385; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 149595.46666666667; 0.06666666666666667; 1.4666666666666666; 0.13333333333333333; 0.06666666666666667 +1377700685; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377700985; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377701285; 1; 2599.9993; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1377701585; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1377701885; 1; 2599.9993; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377702185; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1377702485; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 107652.26666666666; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377702785; 1; 2599.9993; 0.0; 0.0; 2097152.0; 184547.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1377703085; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1377703385; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377703685; 1; 2599.9993; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1377703985; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 123031.73333333334; 0.0; 6.8; 0.2; 0.13333333333333333 +1377704285; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377704585; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1377704885; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1377705185; 1; 2599.9993; 74.53331326666667; 2.8666666666666667; 2097152.0; 657105.6; 161.33333333333334; 22.2; 0.26666666666666666; 0.4 +1377705485; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 374688.26666666666; 0.0; 5.133333333333334; 1.2666666666666666; 0.0 +1377705785; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 218101.33333333334; 31.8; 3.4; 0.0; 0.0 +1377706085; 1; 2599.9993; 10.3999972; 0.4; 2097152.0; 160780.53333333333; 0.0; 3.8; 0.0; 0.5333333333333333 +1377706385; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 137013.06666666668; 0.0; 1.3333333333333333; 0.0; 0.0 +1377706685; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 139809.33333333334; 0.0; 11.533333333333333; 0.0; 0.0 +1377706986; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377707286; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1377707586; 1; 2599.9993; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1377707886; 1; 2599.9993; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.6; 0.0; 0.0 +1377708186; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377708486; 1; 2599.9993; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.6; 0.06666666666666667; 0.0 +1377708786; 1; 2599.9993; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1377709086; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.0; 0.0 +1377709386; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 102059.73333333334; 0.0; 6.866666666666666; 0.26666666666666666; 0.2 +1377709686; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 152392.53333333333; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377709986; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 0.8; 0.0; 0.0 +1377710286; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377710586; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377710886; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377711186; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1377711486; 1; 2599.9993; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377711786; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377712086; 1; 2599.9993; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377712386; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377712686; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6; 0.0; 0.0 +1377712986; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377713286; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 110448.26666666666; 0.2; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1377713586; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 142604.53333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377713886; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377714186; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 111846.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377714486; 1; 2599.9993; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377714786; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1377715086; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1377715386; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377715686; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 130021.6; 0.0; 7.066666666666666; 0.2; 0.13333333333333333 +1377715987; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377716287; 1; 2599.9993; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.6; 0.0; 0.0 +1377716587; 1; 2599.9993; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.6; 0.0; 0.0 +1377716887; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 86680.26666666666; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377717187; 1; 2599.9993; 0.0; 0.0; 2097152.0; 144003.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377717487; 1; 2599.9993; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.5333333333333333; 0.0; 0.0 +1377717787; 1; 2599.9993; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377718087; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377718387; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 88078.4; 161.73333333333332; 13.333333333333334; 0.0; 0.06666666666666667 +1377718687; 1; 2599.9993; 38.13332306666666; 1.4666666666666666; 2097152.0; 517296.0; 0.0; 2.2666666666666666; 0.0; 0.06666666666666667 +1377718987; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 223694.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1377719286; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 197129.33333333334; 31.8; 3.8666666666666667; 0.0; 0.0 +1377719586; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127225.6; 0.0; 0.8; 0.0; 0.0 +1377719886; 1; 2599.9993; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377720186; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 132818.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1377720486; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 141206.66666666666; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377720786; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 169168.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377721086; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1377721386; 1; 2599.9993; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377721686; 1; 2599.9993; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.8; 0.0; 0.0 +1377721986; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377722286; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 104856.0; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1377722586; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377722886; 1; 2599.9993; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377723186; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377723486; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377723787; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377724087; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 88078.4; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1377724387; 1; 2599.9993; 0.0; 0.0; 2097152.0; 148196.53333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377724687; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377724987; 1; 2599.9993; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377725287; 1; 2599.9993; 0.0; 0.0; 2097152.0; 162177.33333333334; 0.0; 0.8; 0.0; 0.0 +1377725587; 1; 2599.9993; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377725887; 1; 2599.9993; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8; 0.0; 0.0 +1377726187; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377726487; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377726787; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377727087; 1; 2599.9993; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377727387; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377727687; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 127225.86666666667; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377727987; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 170566.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377728287; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377728587; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 128624.26666666666; 0.0; 7.0; 0.26666666666666666; 0.13333333333333333 +1377728887; 1; 2599.9993; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377729187; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 81087.73333333334; 0.06666666666666667; 1.3333333333333333; 0.06666666666666667; 0.06666666666666667 +1377729487; 1; 2599.9993; 0.0; 0.0; 2097152.0; 144003.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377729787; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377730087; 1; 2599.9993; 0.0; 0.0; 2097152.0; 138409.86666666667; 0.0; 0.8; 0.0; 0.0 +1377730387; 1; 2599.9993; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377730687; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1377730987; 1; 2599.9993; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377731288; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 138410.4; 0.4666666666666667; 2.2666666666666666; 0.0; 0.5333333333333333 +1377731588; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377731888; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 79689.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377732188; 1; 2599.9993; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377732488; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.6; 0.0; 0.0 +1377732788; 1; 2599.9993; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1377733088; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 67106.4; 0.0; 1.0; 0.0; 0.0 +1377733388; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.6; 0.0; 0.0 +1377733688; 1; 2599.9993; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1377733988; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377734288; 1; 2599.9993; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.0; 0.0 +1377734588; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377734888; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 111846.66666666667; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1377735188; 1; 2599.9993; 0.0; 0.0; 2097152.0; 171964.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377735488; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 146799.2; 0.06666666666666667; 6.933333333333334; 0.2; 0.13333333333333333 +1377735788; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.4; 0.0; 0.0 +1377736088; 1; 2599.9993; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377736388; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 130022.4; 0.0; 1.4; 0.0; 0.0 +1377736688; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377736988; 1; 2599.9993; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377737288; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377737588; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377738188; 1; 2599.9993; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.6; 0.0; 0.0 +1377738489; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 106253.33333333333; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377738789; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 149594.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377739089; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377739389; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377739689; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.6; 0.0; 0.0 +1377739989; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377740289; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377740589; 1; 2599.9993; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377740889; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377741189; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 144002.66666666666; 0.0; 7.133333333333334; 0.26666666666666666; 0.13333333333333333 +1377741489; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377741789; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1377742089; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 92272.8; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377742389; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377742689; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377742989; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377743289; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377743589; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377743889; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127225.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377744189; 1; 2599.9993; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377744489; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377744789; 1; 2599.9993; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377745089; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377745389; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377745689; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 131420.53333333333; 0.0; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1377745989; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 171964.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377746289; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127225.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377746589; 1; 2599.9993; 0.0; 0.0; 2097152.0; 142604.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377746889; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377747189; 1; 2599.9993; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377747489; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 92272.8; 0.2; 7.133333333333334; 0.3333333333333333; 0.13333333333333333 +1377747789; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 142605.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377748089; 1; 2599.9993; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1377748389; 1; 2599.9993; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.0; 0.0; 0.0 +1377748690; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377748990; 1; 2599.9993; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.0; 0.0 +1377749290; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1377749590; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377749890; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377750190; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 113244.8; 0.0; 11.933333333333334; 0.0; 0.0 +1377750490; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377750790; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377751090; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377751390; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377751690; 1; 2599.9993; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377751990; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1377752289; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377752589; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377752889; 1; 2599.9993; 12.133330066666666; 0.4666666666666666; 2097152.0; 142604.53333333333; 0.0; 8.8; 0.26666666666666666; 0.6666666666666666 +1377753189; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 171965.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377753489; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377753789; 1; 2599.9993; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377754089; 1; 2599.9993; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377754389; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1377754689; 1; 2599.9993; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 0.8; 0.0; 0.0 +1377754989; 1; 2599.9993; 0.0; 0.0; 2097152.0; 125827.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377755289; 1; 2599.9993; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377755589; 1; 2599.9993; 0.0; 0.0; 2097152.0; 167770.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377755890; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377756190; 1; 2599.9993; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8; 0.0; 0.0 +1377756490; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 103456.8; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377756790; 1; 2599.9993; 0.0; 0.0; 2097152.0; 159381.6; 0.06666666666666667; 0.8666666666666667; 0.0; 0.0 +1377757090; 1; 2599.9993; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377757390; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1377757690; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377757990; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 1.9333333333333333; 0.06666666666666667; 0.06666666666666667 +1377758290; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.6; 0.0; 0.0 +1377758590; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 1.3333333333333333; 0.0; 0.0 +1377758890; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 149594.66666666666; 12.733333333333333; 12.866666666666667; 0.26666666666666666; 0.13333333333333333 +1377759190; 1; 2599.9993; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 1.4; 0.0; 0.0 +1377759490; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377759790; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377760090; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 120235.46666666666; 0.06666666666666667; 2.6; 0.0; 0.4666666666666667 +1377760390; 1; 2599.9993; 0.0; 0.0; 2097152.0; 176158.4; 0.0; 0.8; 0.0; 0.0 +1377760690; 1; 2599.9993; 0.0; 0.0; 2097152.0; 125827.2; 0.0; 0.8; 0.0; 0.0 +1377760990; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377761290; 1; 2599.9993; 0.0; 0.0; 2097152.0; 62912.0; 0.0; 1.0; 0.0; 0.0 +1377761590; 1; 2599.9993; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8; 0.0; 0.0 +1377761890; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377762190; 1; 2599.9993; 57.19998460000001; 2.2; 2097152.0; 634736.5333333333; 161.06666666666666; 22.533333333333335; 0.06666666666666667; 0.4 +1377762490; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 507508.8; 0.0; 2.7333333333333334; 0.0; 0.0 +1377762790; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 260044.8; 31.8; 3.8666666666666667; 0.0; 0.0 +1377763090; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 159382.4; 0.0; 2.2; 0.0; 0.0 +1377763390; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 145401.06666666668; 0.0; 2.2666666666666666; 0.0; 0.0 +1377763690; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 117439.2; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377763990; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 163576.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377764290; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377764590; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377764890; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377765191; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 6.733333333333333; 0.2; 0.13333333333333333 +1377765491; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 117438.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1377765791; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377766091; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 0.8; 0.06666666666666667; 0.0 +1377766391; 1; 2599.9993; 0.0; 0.0; 2097152.0; 67106.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377766691; 1; 2599.9993; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1377766991; 1; 2599.9993; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377767291; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 180353.06666666668; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1377767591; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 216704.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377767891; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377768191; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377768491; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1377768791; 1; 2599.9993; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1377769091; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 81087.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377769391; 1; 2599.9993; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 1.0; 0.0; 0.0 +1377769691; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 57319.46666666667; 0.0; 1.2; 0.0; 0.0 +1377769991; 1; 2599.9993; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.8; 0.0; 0.0 +1377770291; 1; 2599.9993; 0.0; 0.0; 2097152.0; 64310.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377770591; 1; 2599.9993; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377770891; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.06666666666666667; 2.6666666666666665; 0.0; 0.4666666666666667 +1377771191; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 145401.06666666668; 0.0; 0.8; 0.0; 0.0 +1377771491; 1; 2599.9993; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377771791; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377772091; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 137013.06666666668; 0.06666666666666667; 6.666666666666667; 0.2; 0.13333333333333333 +1377772391; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1377772691; 1; 2599.9993; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377772991; 1; 2599.9993; 0.0; 0.0; 2097152.0; 131420.0; 0.0; 0.8; 0.0; 0.0 +1377773291; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.13333333333; 0.0; 1.0; 0.0; 0.0 +1377773591; 1; 2599.9993; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377773891; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377774191; 1; 2599.9993; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.8; 0.0; 0.0 +1377774491; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 113244.8; 0.0; 2.2; 0.0; 0.4666666666666667 +1377774791; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 197130.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377775091; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1377775391; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377775691; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377775991; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377776291; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377776591; 1; 2599.9993; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377776892; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.2; 0.0; 0.0 +1377777192; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377777492; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377777792; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 120235.46666666666; 0.0; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1377778092; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 138410.4; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377778392; 1; 2599.9993; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1377778692; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377778992; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 124429.86666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1377779292; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377779592; 1; 2599.9993; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377779892; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377780192; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377780492; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 1.6666666666666667; 0.0; 0.0 +1377780792; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377781092; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 0.6; 4.066666666666666; 0.0 +1377781392; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 124429.86666666667; 0.0; 0.6; 0.0; 0.0 +1377781692; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 2.1333333333333333; 0.0; 0.4666666666666667 +1377781992; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 166372.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377782292; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.5333333333333333; 0.0; 0.0 +1377782592; 1; 2599.9993; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.6; 0.0; 0.0 +1377782892; 1; 2599.9993; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377783192; 1; 2599.9993; 0.0; 0.0; 2097152.0; 120234.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377783492; 1; 2599.9993; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1377783792; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377784092; 1; 2599.9993; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377784392; 1; 2599.9993; 0.0; 0.0; 2097152.0; 131419.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377784692; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 106254.13333333333; 0.0; 7.0; 0.2; 0.13333333333333333 +1377784992; 1; 2599.9993; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.6; 0.0; 0.0 +1377785292; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 96467.2; 0.06666666666666667; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377785591; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 159381.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377785891; 1; 2599.9993; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377786192; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377786492; 1; 2599.9993; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.6; 0.0; 0.0 +1377786792; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 92272.8; 0.06666666666666667; 1.4; 0.06666666666666667; 0.13333333333333333 +1377787092; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377787392; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.6; 0.0; 0.0 +1377787692; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377787992; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377788292; 1; 2599.9993; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377788592; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.06666666666666667; 1.0; 0.0; 0.0 +1377788892; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 118837.33333333333; 0.0; 2.3333333333333335; 0.26666666666666666; 0.4666666666666667 +1377789192; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 162177.86666666667; 0.0; 0.8; 0.0; 0.0 +1377789492; 1; 2599.9993; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1377789792; 1; 2599.9993; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377790092; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377790392; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 124429.06666666667; 0.0; 7.066666666666666; 0.2; 0.13333333333333333 +1377790692; 1; 2599.9993; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.0; 0.0 +1377790992; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1377791292; 1; 2599.9993; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.0; 0.0 +1377791592; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377791892; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377792192; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377792492; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 114642.93333333333; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1377792792; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 146798.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377793092; 1; 2599.9993; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377793392; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377793692; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 11.733333333333333; 0.0; 0.0 +1377793992; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377794292; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377794592; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377794892; 1; 2599.9993; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 1.0; 0.0; 0.0 +1377795192; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377795492; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377795793; 1; 2599.9993; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377796093; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 125828.0; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1377796393; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 159381.6; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1377796693; 1; 2599.9993; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377796993; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377797293; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377797593; 1; 2599.9993; 0.0; 0.0; 2097152.0; 135614.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377797893; 1; 2599.9993; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377798193; 1; 2599.9993; 0.0; 0.0; 2097152.0; 146800.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377798493; 1; 2599.9993; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 1.1333333333333333; 0.0; 0.0 +1377798793; 1; 2599.9993; 0.0; 0.0; 2097152.0; 155187.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377799093; 1; 2599.9993; 0.0; 0.0; 2097152.0; 139809.33333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377799393; 1; 2599.9993; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377799693; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 81087.73333333334; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1377799993; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377800293; 1; 2599.9993; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377800593; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377800893; 1; 2599.9993; 0.0; 0.0; 2097152.0; 169168.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377801193; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377801493; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377801793; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 6.733333333333333; 0.2; 0.13333333333333333 +1377802093; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377802393; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1377802693; 1; 2599.9993; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377802993; 1; 2599.9993; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377803293; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 99263.46666666666; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377803593; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 160779.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377803893; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377804194; 1; 2599.9993; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377804494; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377804794; 1; 2599.9993; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 0.8; 0.0; 0.0 +1377805094; 1; 2599.9993; 39.866655933333334; 1.5333333333333334; 2097152.0; 436205.86666666664; 161.0; 14.2; 0.0; 0.2 +1377805394; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 257248.26666666666; 0.0; 1.4; 0.0; 0.0 +1377805694; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 184547.73333333334; 31.8; 3.7333333333333334; 0.0; 0.0 +1377805994; 1; 2599.9993; 0.0; 0.0; 2097152.0; 155187.46666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377806294; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377806594; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.6; 0.0; 0.0 +1377806894; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 90874.66666666667; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377807194; 1; 2599.9993; 0.0; 0.0; 2097152.0; 153789.06666666668; 0.0; 0.5333333333333333; 0.0; 0.0 +1377807494; 1; 2599.9993; 0.0; 0.0; 2097152.0; 169169.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377807794; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 131420.26666666666; 0.06666666666666667; 6.8; 0.2; 0.13333333333333333 +1377808094; 1; 2599.9993; 0.0; 0.0; 2097152.0; 130021.86666666667; 0.0; 0.6; 0.0; 0.0 +1377808394; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.0; 0.0 +1377808694; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377808994; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377809294; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.6; 0.0; 0.0 +1377809594; 1; 2599.9993; 0.0; 0.0; 2097152.0; 141207.46666666667; 0.0; 1.0; 0.0; 0.0 +1377809894; 1; 2599.9993; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.8; 0.0; 0.0 +1377810194; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.6; 0.0; 0.0 +1377810494; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 124429.06666666667; 0.0; 1.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1377810794; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 180353.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377811094; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1377811394; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.6; 0.06666666666666667; 0.0 +1377811694; 1; 2599.9993; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.6; 0.0; 0.0 +1377811994; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1377812294; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1377812594; 1; 2599.9993; 0.0; 0.0; 2097152.0; 163576.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377812894; 1; 2599.9993; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377813194; 1; 2599.9993; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377813494; 1; 2599.9993; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377813794; 1; 2599.9993; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377814094; 1; 2599.9993; 10.3999972; 0.4; 2097152.0; 92272.8; 0.0; 8.0; 0.3333333333333333; 0.6666666666666666 +1377814395; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 145401.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1377814695; 1; 2599.9993; 0.0; 0.0; 2097152.0; 146800.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377814995; 1; 2599.9993; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377815295; 1; 2599.9993; 17.33332866666667; 0.6666666666666667; 2097152.0; 160780.53333333333; 161.0; 20.6; 0.06666666666666667; 0.4 +1377815595; 1; 2599.9993; 48.533320266666664; 1.8666666666666665; 2097152.0; 781536.8; 0.0; 4.2; 0.06666666666666667; 0.13333333333333333 +1377815895; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 367698.93333333335; 31.8; 3.0; 0.0; 0.0 +1377816195; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 219500.0; 0.0; 2.6; 0.0; 0.0 +1377816495; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 134216.8; 0.0; 1.8; 0.0; 0.0 +1377816795; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 132818.66666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377817095; 1; 2599.9993; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377817395; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377817694; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 114642.66666666667; 0.2; 2.7333333333333334; 0.0; 0.4666666666666667 +1377817994; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 157982.93333333332; 0.0; 1.1333333333333333; 0.0; 0.0 +1377818294; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377818594; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377818894; 1; 2599.9993; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377819194; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.2; 1.0; 0.0; 0.0 +1377819494; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377819794; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377820094; 1; 2599.9993; 0.0; 0.0; 2097152.0; 141206.66666666666; 0.0; 1.2; 0.0; 0.0 +1377820394; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 170566.66666666666; 12.733333333333333; 16.8; 0.4; 0.13333333333333333 +1377820694; 1; 2599.9993; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.5333333333333334; 0.0; 0.0 +1377820994; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377821294; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 114642.13333333333; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377821594; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 157983.46666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377821894; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377822194; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377822494; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377822794; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 146800.0; 0.0; 1.4; 0.0; 0.0 +1377823094; 1; 2599.9993; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377823394; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377823694; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377823994; 1; 2599.9993; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377824294; 1; 2599.9993; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.8; 0.0; 0.0 +1377824595; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377824895; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 117438.93333333333; 0.0; 3.2; 0.06666666666666667; 0.4666666666666667 +1377825195; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 145400.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377825495; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377825795; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377826095; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377826395; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 7.2; 0.2; 0.13333333333333333 +1377826695; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377826995; 1; 2599.9993; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377827295; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377827595; 1; 2599.9993; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1377827895; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.8; 0.0; 0.0 +1377828195; 1; 2599.9993; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377828495; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 130021.6; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377828795; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 167771.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377829095; 1; 2599.9993; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1377829395; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377829695; 1; 2599.9993; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377829995; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377830295; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377830595; 1; 2599.9993; 0.0; 0.0; 2097152.0; 125827.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377830895; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377831195; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377831495; 1; 2599.9993; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377831795; 1; 2599.9993; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 1.0; 0.0; 0.0 +1377832095; 1; 2599.9993; 10.3999972; 0.4; 2097152.0; 125826.93333333333; 0.06666666666666667; 8.6; 0.2; 0.6 +1377832395; 1; 2599.9993; 0.0; 0.0; 2097152.0; 146798.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377832695; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377832995; 1; 2599.9993; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1377833295; 1; 2599.9993; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377833595; 1; 2599.9993; 0.0; 0.0; 2097152.0; 159382.13333333333; 0.0; 0.8; 0.0; 0.0 +1377833895; 1; 2599.9993; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377834195; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1377834495; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1377834795; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377835095; 1; 2599.9993; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 0.8; 0.0; 0.0 +1377835395; 1; 2599.9993; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1377835695; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 103457.86666666667; 0.0; 2.2; 0.0; 0.4666666666666667 +1377835996; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 142605.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377836296; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377836596; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377836896; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377837196; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377837496; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 11.733333333333333; 0.0; 0.0 +1377837796; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377838096; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 127226.13333333333; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1377838396; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377838696; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377838996; 1; 2599.9993; 0.0; 0.0; 2097152.0; 67106.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1377839296; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 89476.53333333334; 0.0; 1.9333333333333333; 0.06666666666666667; 0.4666666666666667 +1377839596; 1; 2599.9993; 0.0; 0.0; 2097152.0; 163576.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377839896; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377840196; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1377840496; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377840796; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 145401.86666666667; 0.0; 1.6666666666666667; 0.0; 0.0 +1377841096; 1; 2599.9993; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 1.0; 0.0; 0.0 +1377841396; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377841696; 1; 2599.9993; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1377841996; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377842296; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1377842596; 1; 2599.9993; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377842896; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 113244.8; 0.06666666666666667; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1377843196; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 159382.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377843496; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 113244.8; 0.06666666666666667; 6.933333333333334; 0.2; 0.13333333333333333 +1377843796; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377844096; 1; 2599.9993; 0.0; 0.0; 2097152.0; 106253.6; 0.0; 0.8; 0.0; 0.0 +1377844396; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 141205.86666666667; 0.0; 1.9333333333333333; 0.06666666666666667; 0.13333333333333333 +1377844696; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 130022.4; 0.0; 1.4666666666666666; 0.0; 0.0 +1377844997; 1; 2599.9993; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377845297; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377845597; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1377845897; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1377846197; 1; 2599.9993; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377846497; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 106254.13333333333; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377846797; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 163576.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377847097; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377847397; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1377847697; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1377847997; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377848297; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 138411.2; 0.0; 1.0; 0.0; 0.0 +1377848597; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.3333333333333333; 0.0; 0.0 +1377848897; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1377849197; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377849497; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 121633.6; 0.0; 7.333333333333333; 0.26666666666666666; 0.2 +1377849797; 1; 2599.9993; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377850097; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 100661.6; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1377850397; 1; 2599.9993; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 0.7333333333333333; 0.26666666666666666; 0.0 +1377850696; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.6; 0.06666666666666667; 0.0 +1377850996; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1377851296; 1; 2599.9993; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377851596; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6; 0.0; 0.0 +1377851896; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377852196; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377852496; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1377852796; 1; 2599.9993; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377853096; 1; 2599.9993; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.6; 0.0; 0.0 +1377853396; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1377853696; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 120235.46666666666; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377853996; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 159383.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377854297; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100660.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377854597; 1; 2599.9993; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.8; 0.0; 0.0 +1377854897; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1377855197; 1; 2599.9993; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377855497; 1; 2599.9993; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377855797; 1; 2599.9993; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8; 0.13333333333333333; 0.0 +1377856097; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 144003.73333333334; 0.2; 7.133333333333334; 0.2; 0.13333333333333333 +1377856397; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.5333333333333333; 0.0; 0.0 +1377856697; 1; 2599.9993; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.3333333333333333; 0.0 +1377856997; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1377857297; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 127225.06666666667; 0.0; 1.8666666666666667; 0.0; 0.4666666666666667 +1377857597; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 121632.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377857897; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377858197; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377858497; 1; 2599.9993; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377858797; 1; 2599.9993; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1377859097; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377859397; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1377859697; 1; 2599.9993; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377859997; 1; 2599.9993; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377860297; 1; 2599.9993; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.6; 0.13333333333333333; 0.0 +1377860597; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377860897; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 125827.46666666666; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1377861197; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 192935.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377861497; 1; 2599.9993; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.6; 0.0; 0.0 +1377861797; 1; 2599.9993; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377862097; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 130021.6; 0.0; 6.866666666666666; 0.4; 0.13333333333333333 +1377862397; 1; 2599.9993; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377862698; 1; 2599.9993; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.6; 0.0; 0.0 +1377862998; 1; 2599.9993; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.6; 0.0; 0.0 +1377863298; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1377863598; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377863898; 1; 2599.9993; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377864198; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377864498; 1; 2599.9993; 10.3999972; 0.4; 2097152.0; 128624.26666666666; 0.0; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1377864798; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 156586.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377865098; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 128623.46666666666; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1377865398; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377865698; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.2; 0.0 +1377865998; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377866298; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1377866598; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377866898; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 3.066666666666667; 0.0 +1377867198; 1; 2599.9993; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377867498; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377867798; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.2; 0.0 +1377868098; 1; 2599.9993; 10.3999972; 0.4; 2097152.0; 181750.93333333332; 0.06666666666666667; 8.533333333333333; 0.4; 0.6 +1377868398; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 208315.2; 0.0; 1.0; 0.13333333333333333; 0.0 +1377868698; 1; 2599.9993; 60.66665033333334; 2.3333333333333335; 2097152.0; 227889.33333333334; 161.06666666666666; 21.933333333333334; 0.06666666666666667; 0.4 +1377868998; 1; 2599.9993; 13.866662933333332; 0.5333333333333333; 2097152.0; 673882.4; 0.0; 2.466666666666667; 0.06666666666666667; 0.0 +1377869298; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 285210.13333333336; 31.8; 4.466666666666667; 0.06666666666666667; 0.0 +1377869598; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 208314.4; 0.0; 2.2666666666666666; 0.0; 0.0 +1377869898; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 149596.26666666666; 0.0; 1.6; 0.0; 0.0 +1377870198; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377870498; 1; 2599.9993; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.26666666666666666; 0.0 +1377870798; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 139808.53333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1377871098; 1; 2599.9993; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377871398; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377871698; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 2.3333333333333335; 0.13333333333333333; 0.4666666666666667 +1377871998; 1; 2599.9993; 10.3999972; 0.4; 2097152.0; 174760.26666666666; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1377872299; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377872599; 1; 2599.9993; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377872899; 1; 2599.9993; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377873199; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.4; 0.06666666666666667; 0.06666666666666667 +1377873499; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 127226.13333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1377873799; 1; 2599.9993; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1377874099; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377874399; 1; 2599.9993; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377874699; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 6.666666666666667; 0.0 +1377874999; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 6.0; 0.3333333333333333; 0.13333333333333333 +1377875299; 1; 2599.9993; 8.666664333333335; 0.33333333333333337; 2097152.0; 150993.86666666667; 0.0; 3.2; 0.0; 0.5333333333333333 +1377875599; 1; 2599.9993; 6.933331466666666; 0.26666666666666666; 2097152.0; 160780.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377875899; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 96467.2; 0.0; 0.8; 0.13333333333333333; 0.0 +1377876199; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1377876499; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.4; 0.0 +1377876799; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377877099; 1; 2599.9993; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1377877399; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1377877699; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 79689.6; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1377877999; 1; 2599.9993; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1377878299; 1; 2599.9993; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377878599; 1; 2599.9993; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377878899; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 95068.53333333334; 0.06666666666666667; 2.7333333333333334; 0.13333333333333333; 0.4666666666666667 +1377879199; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 124428.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377879499; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377879799; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377880100; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377880400; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377880700; 1; 2599.9993; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377881000; 1; 2599.9993; 15.599995799999999; 0.6; 2097152.0; 128624.26666666666; 12.8; 23.933333333333334; 0.3333333333333333; 0.2 +1377881300; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 134216.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1377881600; 1; 2599.9993; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.2; 0.0; 0.0 +1377881900; 1; 2599.9993; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377882200; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377882500; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 79689.6; 0.06666666666666667; 2.6; 0.2; 0.4666666666666667 +1377882800; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 132818.66666666666; 0.0; 0.8; 0.0; 0.0 +1377883100; 1; 2599.9993; 5.1999986; 0.2; 2097152.0; 109050.4; 0.0; 1.0; 0.13333333333333333; 0.0 +1377883399; 1; 2599.9993; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8; 0.06666666666666667; 0.0 +1377883699; 1; 2599.9993; 1.7333328666666665; 0.06666666666666667; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377883999; 1; 2599.9993; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377884299; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 79689.6; 0.0; 1.2; 0.0; 0.0 +1377884599; 1; 2599.9993; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377884899; 1; 2599.9993; 3.466665733333333; 0.13333333333333333; 2097152.0; 86680.26666666666; 0.0; 1.0; 0.06666666666666667; 0.0 +1377885199; 1; 2599.9993; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1377885499; 1; 2599.9993; 0.0; 0.0; 2097152.0; 132817.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377885799; 1; 2599.999602; 11.99999816307692; 0.4615384615384615; 2097152.0; 96789.84615384616; 0.0; 0.8333333333333334; 0.0; 0.0 +1377886099; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 162178.4; 0.06666666666666667; 2.3333333333333335; 0.13333333333333333; 0.4666666666666667 +1377886400; 1; 2599.999602; 0.0; 0.0; 2097152.0; 163575.46666666667; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377886700; 1; 2599.999602; 5.199999203999999; 0.2; 2097152.0; 162178.66666666666; 0.0; 7.0; 0.26666666666666666; 0.2 +1377887000; 1; 2599.999602; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377887300; 1; 2599.999602; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377887600; 1; 2599.999343; 25.99999343; 1.0; 2097152.0; 119836.0; 0.0; 0.8461538461538461; 0.07692307692307693; 0.0 +1377887900; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377888200; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 127226.13333333333; 0.0; 0.8; 0.0; 0.0 +1377888500; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 103457.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377888800; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 125828.0; 0.0; 0.8; 0.5333333333333333; 0.0 +1377889100; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1377889400; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 68504.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377889700; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1377890000; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 157984.26666666666; 0.0; 0.8; 0.0; 0.0 +1377890300; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377890600; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377890900; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1377891200; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1377891500; 1; 2599.999343; 50.266653964666666; 1.9333333333333333; 2097152.0; 462770.4; 161.06666666666666; 14.533333333333333; 0.06666666666666667; 0.2 +1377891800; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 276821.6; 0.0; 1.4666666666666666; 0.0; 0.0 +1377892100; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 212510.13333333333; 31.8; 4.0; 0.0; 0.0 +1377892400; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 150994.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377892700; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377893000; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 124429.86666666667; 0.06666666666666667; 7.066666666666666; 0.2; 0.13333333333333333 +1377893300; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 142604.26666666666; 0.0; 2.466666666666667; 0.0; 0.5333333333333333 +1377893600; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 148197.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1377893900; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377894200; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377894500; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.9333333333333333; 0.4666666666666667; 0.0 +1377894800; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377895100; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 125828.0; 0.0; 1.0; 1.0666666666666667; 0.0 +1377895400; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377895700; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377896000; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377896300; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377896600; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377896901; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 141207.46666666667; 0.0; 2.466666666666667; 0.06666666666666667; 0.5333333333333333 +1377897201; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 144002.93333333332; 0.0; 0.8; 0.0; 0.0 +1377897501; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1377897801; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1377898101; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 81087.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377898401; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 79689.6; 0.0; 0.8; 0.2; 0.0 +1377898701; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 139809.33333333334; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1377899001; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 131420.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377899301; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377899601; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1377899901; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 88078.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1377900201; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377900501; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130022.13333333333; 0.0; 1.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1377900801; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 159381.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377901101; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118836.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377901401; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106253.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377901701; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.5333333333333334; 0.0; 0.0 +1377902001; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 114642.93333333333; 0.06666666666666667; 1.7333333333333334; 0.06666666666666667; 0.13333333333333333 +1377902301; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377902601; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1377902901; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377903201; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1377903502; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377903802; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 81087.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377904102; 1; 2599.999343; 25.99999343; 1.0; 2097152.0; 156585.6; 0.26666666666666666; 2.0; 0.06666666666666667; 0.4666666666666667 +1377904402; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 176159.46666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377904702; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377905002; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 7.0; 0.2; 0.13333333333333333 +1377905302; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 139808.53333333333; 0.0; 1.2; 0.06666666666666667; 0.0 +1377905602; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 102059.46666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377905902; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 92272.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377906202; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1377906502; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1377906802; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1377907102; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 113244.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377907402; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377907702; 1; 2599.999343; 24.266660534666663; 0.9333333333333332; 2097152.0; 125827.73333333334; 0.0; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1377908002; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 169168.0; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1377908302; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110448.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377908602; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377908902; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377909202; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 110448.53333333334; 0.0; 1.4666666666666666; 0.0; 0.0 +1377909502; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377909802; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.26666666666666666; 0.0 +1377910102; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.26666666666666666; 0.0 +1377910402; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377910702; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1377911002; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 123031.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377911302; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 139808.0; 0.06666666666666667; 2.2666666666666666; 0.0; 0.5333333333333333 +1377911602; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 152391.2; 0.06666666666666667; 0.7333333333333333; 0.0; 0.0 +1377911902; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 123031.46666666666; 0.0; 7.2; 0.2; 0.13333333333333333 +1377912202; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 134216.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377912502; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1377912802; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377913102; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377913402; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377913702; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1377914003; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 96467.2; 0.0; 1.6; 0.0; 0.0 +1377914303; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377914603; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1377914903; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1377915203; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.8; 0.0; 0.0 +1377915503; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 139809.33333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377915803; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 134216.8; 0.0; 0.8; 0.0; 0.0 +1377916102; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1377916402; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377916702; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377917002; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377917302; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377917602; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377917902; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377918202; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 120234.4; 0.0; 6.8; 0.26666666666666666; 0.13333333333333333 +1377918502; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 155187.2; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1377918802; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377919102; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 5.133333333333334; 0.0 +1377919402; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377919702; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1377920002; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 0.6; 0.0; 0.0 +1377920302; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377920602; 1; 2599.999343; 67.59998291800001; 2.6; 2097152.0; 336940.0; 161.0; 21.8; 0.06666666666666667; 0.4 +1377920903; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 634736.0; 0.0; 2.7333333333333334; 0.0; 0.0 +1377921203; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 292201.3333333333; 31.8; 3.4; 0.06666666666666667; 0.0 +1377921503; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 205517.86666666667; 0.0; 2.3333333333333335; 0.0; 0.0 +1377921803; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 150993.6; 0.0; 1.5333333333333334; 0.0; 0.0 +1377922103; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 139808.53333333333; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1377922403; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 166372.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377922703; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.6; 0.0; 0.0 +1377923003; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377923303; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 125828.0; 0.0; 0.6; 0.0; 0.0 +1377923603; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 128624.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377923903; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 0.6; 0.0; 0.0 +1377924203; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 81087.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377924503; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 61513.86666666667; 0.0; 1.0; 0.0; 0.0 +1377924803; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 71300.8; 0.0; 11.666666666666666; 0.0; 0.0 +1377925103; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 95069.06666666667; 0.0; 6.2; 0.2; 0.13333333333333333 +1377925403; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 116041.06666666667; 0.0; 1.7333333333333334; 0.0; 0.0 +1377925703; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 153789.6; 0.06666666666666667; 2.533333333333333; 0.13333333333333333; 0.5333333333333333 +1377926003; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 226490.13333333333; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1377926303; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 132818.66666666666; 0.0; 0.6; 0.06666666666666667; 0.0 +1377926603; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 0.6; 0.0; 0.0 +1377926903; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377927203; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377927503; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.5333333333333333; 0.0; 0.0 +1377927803; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1377928103; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377928403; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 100661.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377928703; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1377929003; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 81087.73333333334; 0.0; 0.6; 0.06666666666666667; 0.0 +1377929303; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 134215.73333333334; 0.06666666666666667; 2.2666666666666666; 0.2; 0.5333333333333333 +1377929604; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1377929904; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377930204; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 132818.66666666666; 0.0; 0.5333333333333333; 0.0; 0.0 +1377930504; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1377930804; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 104856.0; 0.0; 8.133333333333333; 0.26666666666666666; 0.2 +1377931104; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.4; 0.0; 0.0 +1377931404; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1377931704; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 104856.0; 0.0; 0.6; 0.0; 0.0 +1377932004; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 118837.33333333333; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1377932304; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 96467.2; 0.0; 0.6; 0.0; 0.0 +1377932604; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1377932904; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 79689.6; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377933204; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377933504; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121632.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377933804; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1377934104; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377934404; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377934704; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377935004; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 103457.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1377935304; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1377935604; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1377935904; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377936204; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377936504; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130021.6; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377936804; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 152390.93333333332; 0.0; 6.8; 0.2; 0.13333333333333333 +1377937104; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.06666666666666667; 1.5333333333333334; 0.06666666666666667; 0.0 +1377937404; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 135614.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1377937704; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377938004; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377938304; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1377938604; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377938905; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377939205; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 1.2; 0.0 +1377939505; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 121632.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377939805; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377940105; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 135613.6; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377940405; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 176160.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1377940705; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377941005; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1377941305; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377941605; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377941905; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377942205; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377942505; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 142604.8; 12.733333333333333; 13.266666666666667; 0.3333333333333333; 0.2 +1377942805; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 102059.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377943105; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377943405; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377943705; 1; 2599.999343; 25.99999343; 1.0; 2097152.0; 103457.86666666667; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.5333333333333333 +1377944005; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377944305; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377944605; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377944905; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377945205; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1377945505; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 75495.2; 0.0; 0.8; 0.0; 0.0 +1377945805; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377946105; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377946405; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377946706; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 72698.93333333333; 0.0; 1.0; 0.0; 0.0 +1377947006; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377947306; 1; 2599.999343; 24.266660534666663; 0.9333333333333332; 2097152.0; 139808.53333333333; 0.06666666666666667; 2.2666666666666666; 0.0; 0.5333333333333333 +1377947606; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 188741.6; 0.0; 0.8; 0.0; 0.0 +1377947906; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 117439.2; 0.0; 1.0; 3.066666666666667; 0.0 +1377948206; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 64310.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377948506; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1377948805; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1377949105; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 152391.73333333334; 0.0; 7.466666666666667; 0.26666666666666666; 0.13333333333333333 +1377949405; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1377949705; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 118836.26666666666; 0.0; 1.0; 0.0; 0.0 +1377950005; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130021.33333333333; 0.0; 0.6; 0.0; 0.0 +1377950305; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377950605; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.8; 0.0; 0.0 +1377950905; 1; 2599.999343; 24.266660534666663; 0.9333333333333332; 2097152.0; 125828.0; 0.06666666666666667; 2.4; 0.06666666666666667; 0.5333333333333333 +1377951205; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 159382.4; 0.0; 0.8; 0.0; 0.0 +1377951505; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377951805; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377952105; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 109049.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1377952405; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 76893.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1377952705; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377953005; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1377953306; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377953606; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 103457.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1377953906; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377954206; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377954506; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 142604.0; 0.06666666666666667; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1377954806; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 167770.4; 0.0; 1.0; 0.0; 0.0 +1377955106; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377955406; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1377955706; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377956006; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 118837.33333333333; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1377956306; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 178954.93333333332; 0.0; 1.1333333333333333; 0.0; 0.0 +1377956606; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377956906; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1377957206; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1377957506; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1377957806; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377958106; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 150993.33333333334; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1377958406; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 173363.46666666667; 0.0; 1.6666666666666667; 0.0; 0.0 +1377958706; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377959006; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377959306; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1377959606; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.06666666666666667; 0.13333333333333333 +1377959906; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377960206; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377960506; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1377960806; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377961106; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377961406; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1377961706; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 118837.33333333333; 0.06666666666666667; 2.6; 0.06666666666666667; 0.5333333333333333 +1377962006; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 141206.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377962307; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1377962607; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 138411.2; 0.0; 0.8; 0.0; 0.0 +1377962907; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 125828.0; 0.06666666666666667; 6.8; 0.2; 0.13333333333333333 +1377963207; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 132818.66666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1377963507; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1377963807; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377964107; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377964407; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 121632.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377964707; 1; 2599.999343; 5.199998686; 0.2; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377965007; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 50328.8; 0.0; 0.8; 0.0; 0.0 +1377965307; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109049.86666666667; 0.0; 2.0; 0.06666666666666667; 0.4666666666666667 +1377965607; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 171964.53333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377965907; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377966207; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377966507; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377966807; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377967107; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 68504.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377967407; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377967707; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 86680.26666666666; 0.0; 1.0; 0.0; 0.0 +1377968007; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 142604.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377968307; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 103457.86666666667; 0.0; 17.666666666666668; 0.2; 0.13333333333333333 +1377968607; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377968907; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377969207; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 144002.93333333332; 0.0; 0.8; 0.0; 0.0 +1377969507; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1377969807; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377970107; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377970407; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1377970707; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1377971007; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1377971307; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 75495.2; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1377971607; 1; 2599.999343; 67.59998291800001; 2.6; 2097152.0; 232082.93333333332; 161.0; 21.866666666666667; 0.13333333333333333; 0.3333333333333333 +1377971907; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 727010.4; 0.0; 2.466666666666667; 0.0; 0.0 +1377972207; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 279618.4; 31.8; 3.6; 1.1333333333333333; 0.0 +1377972507; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 191537.6; 0.0; 3.6; 0.06666666666666667; 0.4666666666666667 +1377972807; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 164974.93333333332; 0.0; 1.6; 0.0; 0.0 +1377973107; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 124429.86666666667; 0.0; 0.8; 0.0; 0.0 +1377973407; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.6; 0.0; 0.0 +1377973707; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 95069.06666666667; 0.0; 0.6; 0.0; 0.0 +1377974008; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 110448.53333333334; 0.0; 6.733333333333333; 0.2; 0.13333333333333333 +1377974308; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 85282.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377974608; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377974908; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1377975208; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1377975508; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1377975808; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1377976108; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 149595.46666666667; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1377976408; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 181751.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377976708; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1377977008; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1377977308; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 0.6; 0.0; 0.0 +1377977608; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1377977908; 1; 2599.999343; 50.266653964666666; 1.9333333333333333; 2097152.0; 387272.0; 161.06666666666666; 14.6; 0.0; 0.2 +1377978208; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 315969.6; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1377978508; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 155188.0; 31.8; 3.8666666666666667; 0.0; 0.0 +1377978808; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1377979108; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1377979408; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377979708; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130021.06666666667; 0.06666666666666667; 3.0; 0.06666666666666667; 0.4666666666666667 +1377980008; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 120235.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1377980308; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 7.2; 0.2; 0.13333333333333333 +1377980608; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 111846.66666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1377980908; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 128624.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377981208; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377981508; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1377981808; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1377982108; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1377982408; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1377982708; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1377983008; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1377983308; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 124429.86666666667; 0.06666666666666667; 2.2666666666666666; 0.0; 0.5333333333333333 +1377983608; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1377983908; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1377984208; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1377984508; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377984808; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377985108; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377985408; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 93670.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1377985708; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 149596.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377986008; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 155188.26666666666; 0.0; 0.8; 0.0; 0.0 +1377986308; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 131420.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377986608; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1377986908; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110448.53333333334; 0.06666666666666667; 8.533333333333333; 0.26666666666666666; 0.7333333333333333 +1377987208; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 170566.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1377987508; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 148197.33333333334; 169.66666666666666; 179.2; 0.0; 0.0 +1377987808; 1; 2599.999343; 25.99999343; 1.0; 2097152.0; 243268.0; 0.0; 1.2; 0.0; 0.0 +1377988108; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 145401.33333333334; 0.0; 1.0; 0.0; 0.0 +1377988408; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 134216.8; 0.0; 1.5333333333333334; 0.06666666666666667; 0.13333333333333333 +1377988708; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 142604.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377989008; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 81087.73333333334; 0.0; 0.8; 0.0; 0.0 +1377989309; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1377989609; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 135614.13333333333; 0.0; 1.0; 0.0; 0.0 +1377989909; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377990209; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1377990509; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 138410.13333333333; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1377990809; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 148197.33333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1377991109; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1377991409; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1377991709; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 71300.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1377992009; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1377992309; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1377992609; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1377992909; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 93670.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377993209; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1377993509; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1377993809; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 131420.53333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1377994109; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 164974.66666666666; 0.0; 8.6; 0.26666666666666666; 0.6 +1377994409; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 185944.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1377994709; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 118837.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1377995009; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 86679.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1377995309; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.6; 0.0; 0.0 +1377995609; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1377995909; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 68504.53333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377996209; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1377996509; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1377996809; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1377997109; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 135614.93333333332; 0.0; 0.6; 0.0; 0.0 +1377997409; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 0.5333333333333333; 0.0; 0.0 +1377997709; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 104856.0; 0.06666666666666667; 2.7333333333333334; 0.06666666666666667; 0.5333333333333333 +1377998009; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 163576.0; 0.0; 1.0; 0.0; 0.0 +1377998310; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 95069.06666666667; 0.0; 0.6; 0.0; 0.0 +1377998610; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.6; 0.0; 0.0 +1377998910; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 120235.46666666666; 0.0; 0.6; 0.0; 0.0 +1377999210; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 125827.2; 0.0; 1.0; 0.0; 0.0 +1377999510; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.0; 0.0 +1377999810; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.06666666666666667; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1378000110; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.0; 0.0 +1378000410; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378000710; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378001010; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 111846.66666666667; 0.0; 0.6; 0.0; 0.0 +1378001310; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 124428.8; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1378001610; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 177556.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378001910; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110447.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378002210; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 86680.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1378002510; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 163576.53333333333; 0.0; 0.6; 0.0; 0.0 +1378002810; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 141206.13333333333; 0.0; 1.5333333333333334; 0.13333333333333333; 0.0 +1378003110; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 144002.93333333332; 0.0; 0.8; 0.0; 0.0 +1378003410; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378003710; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 116041.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1378004010; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 145400.53333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1378004310; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 144002.93333333332; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1378004610; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.8; 0.06666666666666667; 0.0 +1378004910; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 127225.06666666667; 0.0; 2.1333333333333333; 0.06666666666666667; 0.5333333333333333 +1378005210; 1; 2599.999343; 327.599917218; 12.6; 2097152.0; 534072.8; 34.2; 753.7333333333333; 149.46666666666667; 32.13333333333333 +1378005510; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 322958.93333333335; 0.0; 1.4; 0.0; 0.0 +1378005810; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 152391.73333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378006110; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 127226.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378006410; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1378006711; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 117439.2; 12.733333333333333; 13.133333333333333; 0.3333333333333333; 0.2 +1378007011; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 153789.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1378007311; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 116041.06666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1378007611; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 123030.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378007911; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378008211; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378008511; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 113244.8; 0.13333333333333333; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1378008811; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 199926.66666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378009111; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 137012.26666666666; 0.0; 1.0; 0.0; 0.0 +1378009411; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378009711; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1378010011; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378010311; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.0; 0.0 +1378010611; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378010911; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378011211; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 75495.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378011511; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 75495.2; 0.0; 1.2; 0.0; 0.0 +1378011811; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378012111; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 113243.46666666666; 0.13333333333333333; 13.533333333333333; 0.0; 0.4666666666666667 +1378012411; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 174761.06666666668; 0.0; 6.133333333333334; 0.2; 0.13333333333333333 +1378012711; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 156586.93333333332; 0.0; 1.9333333333333333; 0.0; 0.0 +1378013011; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 142604.8; 0.0; 1.2666666666666666; 0.0; 0.0 +1378013311; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378013611; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378013912; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1378014211; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.4; 0.0; 0.0 +1378014511; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378014811; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378015111; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378015411; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378015711; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 134216.0; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1378016011; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 167771.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378016311; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378016611; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378016911; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378017211; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 123031.73333333334; 0.0; 2.6; 0.06666666666666667; 0.13333333333333333 +1378017511; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 159381.6; 0.0; 1.8666666666666667; 0.0; 0.0 +1378017811; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378018111; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378018411; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1378018711; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 6.066666666666666; 0.2; 0.13333333333333333 +1378019011; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 2.066666666666667; 0.0; 0.0 +1378019312; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 104856.0; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1378019612; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 163576.0; 0.0; 1.0; 0.0; 0.0 +1378019912; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378020212; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378020512; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378020812; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378021112; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 1.3333333333333333; 0.3333333333333333; 0.0 +1378021412; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1378021712; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 1.2666666666666666; 0.2; 0.0 +1378022012; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 141206.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378022312; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 167770.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378022612; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378022912; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 95069.06666666667; 0.2; 2.4; 0.06666666666666667; 0.5333333333333333 +1378023212; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 142605.6; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378023512; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 75495.2; 0.0; 1.0; 0.13333333333333333; 0.0 +1378023812; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 78291.46666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378024112; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1378024412; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 0.8; 0.13333333333333333; 0.0 +1378024712; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378025012; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 134216.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378025312; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 142604.8; 0.0; 6.266666666666667; 0.3333333333333333; 0.2 +1378025612; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 192936.0; 0.0; 2.1333333333333333; 0.0; 0.0 +1378025912; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378026212; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 139809.33333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378026512; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 149596.26666666666; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1378026812; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 171964.8; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378027112; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378027412; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378027713; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378028013; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378028313; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 156586.13333333333; 0.0; 1.2; 0.0; 0.0 +1378028613; 1; 2599.999343; 69.33331581333334; 2.666666666666667; 2097152.0; 422225.06666666665; 161.0; 21.933333333333334; 0.06666666666666667; 0.4 +1378028913; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 603977.6; 0.0; 2.6; 0.06666666666666667; 0.0 +1378029213; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 226489.6; 31.8; 3.6; 0.0; 0.0 +1378029513; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 184548.0; 0.8; 2.6; 0.0; 0.0 +1378029813; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130022.4; 0.0; 1.7333333333333334; 0.0; 0.0 +1378030113; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 137013.06666666668; 0.0; 2.3333333333333335; 1.4666666666666666; 0.5333333333333333 +1378030413; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 174761.33333333334; 0.0; 1.0; 0.0; 0.0 +1378030713; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378031013; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 159381.6; 0.0; 7.0; 0.26666666666666666; 0.13333333333333333 +1378031313; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378031613; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378031913; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1378032213; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 75495.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378032513; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378032813; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378033113; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.0; 0.0 +1378033413; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378033713; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 121633.6; 0.06666666666666667; 2.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1378034013; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 170566.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378034313; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1378034613; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 79689.6; 0.06666666666666667; 1.4; 0.13333333333333333; 0.0 +1378034913; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110448.53333333334; 0.06666666666666667; 1.4666666666666666; 0.06666666666666667; 0.0 +1378035214; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1378035514; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378035814; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 131419.73333333334; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378036114; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1378036414; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1378036714; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 97865.33333333333; 0.0; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1378037014; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378037314; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.06666666666666667; 2.4; 0.06666666666666667; 0.5333333333333333 +1378037614; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 144002.93333333332; 0.0; 0.8; 0.0; 0.0 +1378037914; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378038214; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378038514; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378038814; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378039114; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.2; 0.0; 0.0 +1378039414; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 103457.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1378039714; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 75495.2; 0.0; 1.0; 0.06666666666666667; 0.0 +1378040014; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 60115.73333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378040314; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1378040614; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378040914; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 128623.73333333334; 0.0; 2.4; 0.13333333333333333; 0.5333333333333333 +1378041214; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 155188.0; 0.0; 1.0; 0.0; 0.0 +1378041514; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378041814; 1; 2599.999343; 5.199998686; 0.2; 2097152.0; 130022.4; 0.0; 1.2; 0.0; 0.0 +1378042114; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 124429.33333333333; 0.0; 7.4; 0.2; 0.13333333333333333 +1378042414; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 137012.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378042715; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378043015; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378043315; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 1.4666666666666666; 0.0; 0.0 +1378043615; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378043915; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378044215; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378044515; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 124429.06666666667; 0.06666666666666667; 2.533333333333333; 0.13333333333333333; 0.4666666666666667 +1378044815; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 159382.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378045115; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378045415; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378045715; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 102059.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378046015; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.06666666666666667; 1.3333333333333333; 0.06666666666666667; 0.13333333333333333 +1378046315; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 107652.26666666666; 0.0; 1.2; 0.0; 0.0 +1378046615; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378046915; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378047215; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 149594.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378047515; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 95069.06666666667; 0.0; 1.8666666666666667; 0.0; 0.0 +1378047815; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378048115; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 176157.86666666667; 0.0; 8.333333333333334; 0.26666666666666666; 0.6 +1378048415; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 138410.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378048715; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1378049015; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 135614.93333333332; 0.0; 1.0666666666666667; 0.0; 0.0 +1378049315; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378049615; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 164974.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378049915; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1378050215; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 88078.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378050515; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.4; 0.0; 0.0 +1378050815; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378051115; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378051415; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 164975.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378051715; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 150992.8; 0.0; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1378052015; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378052315; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 138411.2; 0.0; 0.8; 0.0; 0.0 +1378052615; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378052915; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 145401.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378053215; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378053515; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378053815; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1378054115; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 130021.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378054415; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378054715; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 72698.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378055015; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 125827.2; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1378055315; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 167770.4; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378055615; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 144002.93333333332; 0.0; 12.0; 0.0; 0.0 +1378055916; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378056216; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378056516; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378056816; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378057116; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378057416; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378057716; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 125828.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378058016; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378058316; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378058616; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110448.53333333334; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1378058916; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 176159.2; 0.06666666666666667; 2.6; 0.06666666666666667; 0.5333333333333333 +1378059216; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 222296.0; 0.0; 0.8; 0.06666666666666667; 0.0 +1378059516; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1378059816; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1378060116; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 1.2; 0.0; 0.0 +1378060416; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1378060716; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 131420.53333333333; 0.06666666666666667; 7.133333333333334; 0.26666666666666666; 0.13333333333333333 +1378061016; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 160779.73333333334; 0.06666666666666667; 1.9333333333333333; 0.0; 0.0 +1378061316; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 134216.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378061616; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378061916; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378062216; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 113244.8; 1.4; 1.3333333333333333; 0.0; 0.0 +1378062516; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 127226.13333333333; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1378062816; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378063116; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378063416; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.0; 0.0 +1378063716; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378064017; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 163576.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1378064317; 1; 2599.999343; 50.266653964666666; 1.9333333333333333; 2097152.0; 303386.4; 161.66666666666666; 14.466666666666667; 0.0; 0.2 +1378064617; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 373291.2; 0.0; 1.4; 0.0; 0.0 +1378064917; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 204120.53333333333; 31.8; 4.0; 0.0; 0.0 +1378065217; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 188741.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378065517; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 134216.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378065817; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378066117; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 2.4; 0.06666666666666667; 0.5333333333333333 +1378066417; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 150993.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378066717; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378067017; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378067317; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 150993.6; 12.866666666666667; 13.066666666666666; 0.3333333333333333; 0.13333333333333333 +1378067617; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 184547.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378067917; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378068217; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1378068517; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1378068817; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 0.8; 0.0; 0.0 +1378069117; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 134216.8; 0.0; 0.8; 0.0; 0.0 +1378069417; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378069717; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.2; 3.2; 0.06666666666666667; 0.4666666666666667 +1378070017; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 148197.33333333334; 0.06666666666666667; 0.8; 0.0; 0.0 +1378070317; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378070617; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378070917; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 1.0; 0.0; 0.0 +1378071217; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 0.8; 0.06666666666666667; 0.0 +1378071517; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109049.6; 0.0; 1.2; 0.0; 0.0 +1378071817; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378072117; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378072418; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 79689.6; 0.0; 1.0; 0.0; 0.0 +1378072718; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 118837.33333333333; 0.0; 6.8; 0.2; 0.13333333333333333 +1378073018; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 173362.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378073318; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 144003.46666666667; 0.0; 2.4; 0.2; 0.4666666666666667 +1378073618; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 153789.06666666668; 0.0; 1.0666666666666667; 0.0; 0.0 +1378073918; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378074218; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378074518; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378074818; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 124429.06666666667; 0.0; 1.4; 0.06666666666666667; 0.13333333333333333 +1378075118; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378075418; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 132818.66666666666; 0.0; 0.8; 0.0; 0.0 +1378075718; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 155188.0; 0.0; 0.8; 0.0; 0.0 +1378076018; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378076318; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378076618; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 86680.26666666666; 0.2; 1.4; 0.0; 0.0 +1378076918; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 139807.73333333334; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1378077218; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 223694.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378077518; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 138410.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1378077818; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378078118; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1378078418; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 141207.46666666667; 0.0; 7.4; 0.26666666666666666; 0.13333333333333333 +1378078718; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378079018; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 148198.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378079318; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.4666666666666666; 0.0; 0.0 +1378079618; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1378079918; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378080218; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378080518; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 155188.0; 0.06666666666666667; 2.8666666666666667; 0.06666666666666667; 0.5333333333333333 +1378080818; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 149594.66666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378081118; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378081418; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378081718; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378082018; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 120235.46666666666; 0.6; 1.7333333333333334; 0.0; 0.0 +1378082318; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.0; 0.0 +1378082618; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378082918; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378083218; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378083518; 1; 2599.999343; 51.99998686; 2.0; 2097152.0; 160779.73333333334; 161.0; 22.066666666666666; 0.2; 0.3333333333333333 +1378083818; 1; 2599.999343; 36.399990802; 1.4; 2097152.0; 598384.8; 0.0; 2.7333333333333334; 0.0; 0.0 +1378084118; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 282414.6666666667; 32.6; 5.066666666666666; 0.06666666666666667; 0.5333333333333333 +1378084418; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 209713.33333333334; 0.0; 2.6; 0.0; 0.0 +1378084718; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 153790.66666666666; 0.0; 1.8666666666666667; 0.0; 0.0 +1378085018; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 139808.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378085318; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.0; 7.066666666666666; 0.2; 0.13333333333333333 +1378085618; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.0; 0.0; 0.0 +1378085918; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378086218; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 103457.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378086518; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 114642.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378086818; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378087118; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 141206.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378087418; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 120235.46666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378087718; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 167770.4; 0.0; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1378088018; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 192936.53333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378088319; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 157985.06666666668; 0.0; 0.9333333333333333; 0.0; 0.0 +1378088619; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 150994.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378088919; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 93670.93333333333; 0.0; 1.2; 0.0; 0.0 +1378089219; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378089519; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 86680.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378089819; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 81087.73333333334; 0.0; 1.0; 0.0; 0.0 +1378090119; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1378090419; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 142605.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1378090719; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 90874.66666666667; 0.0; 6.8; 0.26666666666666666; 0.13333333333333333 +1378091019; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378091319; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 128624.26666666666; 0.06666666666666667; 2.6; 0.06666666666666667; 0.5333333333333333 +1378091619; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 170567.46666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378091919; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 120235.46666666666; 0.0; 1.7333333333333334; 0.0; 0.0 +1378092219; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 71300.8; 0.0; 1.0; 0.13333333333333333; 0.0 +1378092519; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378092819; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378093119; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 90874.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378093419; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 64310.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378093719; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378094019; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378094319; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 0.8; 0.0; 0.0 +1378094619; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.06666666666666667; 0.0 +1378094919; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 142605.33333333334; 0.06666666666666667; 2.4; 0.06666666666666667; 0.5333333333333333 +1378095219; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 153788.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378095519; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1378095819; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378096119; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.2; 0.0 +1378096419; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 127226.13333333333; 0.0; 0.8; 0.0; 0.0 +1378096719; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378097019; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.2; 0.0; 0.0 +1378097319; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 65708.26666666666; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1378097619; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378097919; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 97865.33333333333; 0.0; 6.933333333333334; 0.26666666666666666; 0.13333333333333333 +1378098219; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378098519; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 141207.46666666667; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378098819; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 130021.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378099119; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 83884.0; 0.0; 11.866666666666667; 0.0; 0.0 +1378099419; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378099719; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378100019; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378100319; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 144003.73333333334; 0.0; 0.8; 0.0; 0.0 +1378100620; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378100920; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378101220; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378101520; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 75495.2; 0.0; 1.2; 0.0; 0.0 +1378101820; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1378102120; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 99263.46666666666; 0.06666666666666667; 2.4; 0.06666666666666667; 0.4666666666666667 +1378102420; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 127225.33333333333; 0.0; 0.8; 0.0; 0.0 +1378102720; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1378103020; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378103320; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 146800.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378103620; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 103457.86666666667; 0.06666666666666667; 2.6; 0.2; 0.13333333333333333 +1378103920; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 109050.4; 0.0; 1.7333333333333334; 0.0; 0.0 +1378104220; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 144002.93333333332; 0.0; 1.2666666666666666; 0.0; 0.0 +1378104520; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 132817.86666666667; 0.26666666666666666; 7.466666666666667; 0.26666666666666666; 0.13333333333333333 +1378104820; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378105120; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378105420; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 86680.26666666666; 0.0; 1.0; 0.0; 0.0 +1378105720; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 164974.4; 0.0; 2.3333333333333335; 0.13333333333333333; 0.5333333333333333 +1378106020; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 188742.4; 0.0; 1.0; 0.06666666666666667; 0.0 +1378106320; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.9333333333333333; 0.2; 0.0 +1378106620; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.2; 0.0 +1378106920; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 121633.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1378107220; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.7333333333333333; 0.26666666666666666; 0.0 +1378107520; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378107820; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 93670.93333333333; 0.0; 1.2666666666666666; 0.26666666666666666; 0.0 +1378108120; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 121633.6; 0.0; 1.4; 0.06666666666666667; 0.0 +1378108420; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 1.4; 0.06666666666666667; 0.0 +1378108720; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378109020; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118836.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378109320; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 135613.86666666667; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1378109620; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 137012.53333333333; 0.0; 1.0; 0.0; 0.0 +1378109921; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378110221; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378110521; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 128624.26666666666; 0.0; 7.133333333333334; 0.26666666666666666; 0.13333333333333333 +1378110820; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378111120; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.2; 0.0; 0.0 +1378111420; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378111720; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1378112020; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378112320; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378112621; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1378112921; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 139808.0; 0.0; 2.1333333333333333; 0.0; 0.4666666666666667 +1378113221; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 144002.93333333332; 0.0; 1.0; 0.0; 0.0 +1378113521; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378113821; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378114121; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378114421; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.0; 0.0 +1378114721; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378115021; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 103457.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378115321; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.4; 0.0; 0.0 +1378115621; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378115921; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 135614.13333333333; 0.0; 0.8; 0.0; 0.0 +1378116221; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378116521; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 128624.0; 0.0; 2.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1378116821; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 170566.13333333333; 0.0; 7.0; 0.2; 0.13333333333333333 +1378117121; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378117421; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378117721; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.0; 0.0 +1378118021; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1378118321; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 137013.06666666668; 0.0; 0.8; 0.0; 0.0 +1378118621; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378118921; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378119221; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378119521; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 134215.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1378119821; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378120121; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 141206.66666666666; 0.0; 2.4; 0.2; 0.5333333333333333 +1378120421; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 134216.8; 0.0; 1.0; 0.0; 0.0 +1378120721; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1378121021; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1378121321; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 114642.93333333333; 0.0; 0.8; 0.0; 0.0 +1378121622; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 128624.26666666666; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1378121922; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1378122222; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1378122522; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 1.3333333333333333; 0.0; 0.0 +1378122822; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378123122; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 148197.33333333334; 0.0; 0.8; 0.0; 0.0 +1378123422; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 167770.13333333333; 0.0; 7.2; 0.2; 0.13333333333333333 +1378123722; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 152392.0; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1378124022; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 173362.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1378124322; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 139809.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378124622; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1378124922; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.2; 0.0; 0.0 +1378125222; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 86680.26666666666; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1378125522; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378125822; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 92272.8; 0.0; 0.7333333333333333; 0.0; 0.0 +1378126122; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378126422; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378126722; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1378127022; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378127322; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 170567.2; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1378127622; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 150993.06666666668; 0.0; 1.1333333333333333; 0.0; 0.0 +1378127922; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1378128222; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378128522; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378128822; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1378129122; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 139809.33333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378129422; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378129722; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378130022; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1378130322; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 104856.0; 12.733333333333333; 13.066666666666666; 0.3333333333333333; 0.2 +1378130622; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 127225.33333333333; 0.06666666666666667; 1.5333333333333334; 0.0; 0.0 +1378130922; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 139808.53333333333; 0.13333333333333333; 2.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1378131222; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 167770.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378131522; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378131822; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378132122; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378132422; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 92272.8; 0.06666666666666667; 1.3333333333333333; 0.06666666666666667; 0.06666666666666667 +1378132722; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378133023; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 137013.06666666668; 0.0; 1.0; 0.0; 0.0 +1378133323; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1378133623; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378133923; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378134223; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 144003.73333333334; 0.0; 1.0; 0.0; 0.0 +1378134523; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 169168.8; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1378134823; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 180353.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378135123; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378135423; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378135723; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378136023; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378136323; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 1.8; 0.0; 0.0 +1378136623; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 138411.2; 0.0; 7.133333333333334; 0.26666666666666666; 0.13333333333333333 +1378136923; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 1.4; 0.0; 0.0 +1378137223; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378137523; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378137823; 1; 2599.999343; 51.99998686; 2.0; 2097152.0; 152391.46666666667; 161.0; 21.866666666666667; 0.13333333333333333; 0.4 +1378138123; 1; 2599.999343; 43.333322383333325; 1.6666666666666665; 2097152.0; 713029.6; 0.8; 4.333333333333333; 0.06666666666666667; 0.5333333333333333 +1378138423; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 360708.0; 31.8; 3.533333333333333; 0.13333333333333333; 0.0 +1378138723; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 222296.0; 0.0; 2.7333333333333334; 0.06666666666666667; 0.0 +1378139023; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 155188.0; 0.0; 1.8; 0.0; 0.0 +1378139323; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378139623; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378139923; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1378140223; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 102059.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1378140523; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378140824; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378141124; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378141424; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 142605.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378141724; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 125828.0; 0.6; 2.4; 0.06666666666666667; 0.5333333333333333 +1378142024; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 155187.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378142324; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 109050.4; 0.0; 1.0; 0.06666666666666667; 0.0 +1378142624; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378142924; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 138410.4; 0.0; 12.0; 0.0; 0.0 +1378143224; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 134216.53333333333; 0.0; 7.133333333333334; 0.7333333333333333; 0.13333333333333333 +1378143524; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 213906.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378143824; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378144124; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 67106.4; 0.0; 1.0; 0.0; 0.0 +1378144424; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 67106.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378144724; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378145024; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378145324; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 155187.2; 0.0; 2.4; 0.06666666666666667; 0.5333333333333333 +1378145624; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 138410.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378145924; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378146224; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378146524; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378146824; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1378147124; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378147424; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378147724; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378148024; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378148324; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 86680.26666666666; 0.0; 1.0; 0.0; 0.0 +1378148624; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378148924; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 163576.0; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1378149224; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 152390.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1378149524; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 100661.6; 0.0; 6.933333333333334; 0.3333333333333333; 0.13333333333333333 +1378149824; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 83884.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1378150124; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378150424; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378150724; 1; 2599.999343; 53.733319755333326; 2.0666666666666664; 2097152.0; 247462.4; 161.73333333333332; 14.333333333333334; 0.0; 0.2 +1378151024; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 364902.4; 0.0; 1.4666666666666666; 0.0; 0.0 +1378151324; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 167771.2; 31.8; 4.0; 0.0; 0.0 +1378151624; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 176159.2; 0.0; 0.8; 0.0; 0.0 +1378151924; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378152224; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378152525; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 99263.46666666666; 0.0; 2.8666666666666667; 0.06666666666666667; 0.5333333333333333 +1378152825; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 153789.06666666668; 0.0; 1.0666666666666667; 0.0; 0.0 +1378153125; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 137012.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378153425; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378153725; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378154025; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378154325; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378154625; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378154925; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378155225; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 83884.0; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1378155525; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378155825; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378156125; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 153789.86666666667; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1378156425; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 130021.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378156725; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 134216.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378157025; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378157325; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378157625; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378157925; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378158225; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 123031.73333333334; 0.0; 1.2; 0.0; 0.0 +1378158525; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378158825; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378159125; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378159425; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 132818.13333333333; 0.0; 2.066666666666667; 0.0; 0.0 +1378159725; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 166371.46666666667; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378160025; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 145401.06666666668; 0.0; 1.0666666666666667; 0.0; 0.0 +1378160325; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 116041.06666666667; 0.0; 1.0; 0.0; 0.0 +1378160625; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378160925; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 93670.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378161225; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 125828.0; 0.06666666666666667; 1.8; 0.06666666666666667; 0.13333333333333333 +1378161525; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378161825; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378162125; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378162425; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 142604.8; 0.0; 7.2; 0.26666666666666666; 0.13333333333333333 +1378162725; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 128623.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378163025; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 171964.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378163325; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 170566.66666666666; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1378163625; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 170566.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378163926; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 141206.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378164226; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 61513.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378164526; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378164826; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378165126; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 107651.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378165426; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1378165726; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378166026; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378166326; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 85282.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378166626; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1378166926; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 102059.73333333334; 0.0; 2.4; 0.06666666666666667; 0.5333333333333333 +1378167226; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378167526; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 135614.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378167826; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 124429.33333333333; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1378168126; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 135614.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378168426; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.5333333333333333; 1.4666666666666666; 0.0; 0.0 +1378168726; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378169026; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378169326; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1378169627; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378169927; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1378170227; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378170527; 1; 2599.999343; 24.266660534666663; 0.9333333333333332; 2097152.0; 131420.0; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1378170827; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 146798.93333333332; 0.0; 1.0; 0.0; 0.0 +1378171127; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 135614.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378171427; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 162178.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378171727; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 132818.66666666666; 0.0; 1.6; 0.0; 0.0 +1378172027; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378172327; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378172627; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1378172927; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 114642.93333333333; 0.0; 0.8; 0.0; 0.0 +1378173227; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378173527; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378173827; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 159381.86666666667; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1378174127; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 137011.46666666667; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1378174427; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 160780.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378174727; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1378175027; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378175327; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378175627; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378175927; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 82485.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378176227; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 78291.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378176527; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378176827; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1378177127; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378177427; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378177727; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 114642.4; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1378178027; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 184546.13333333333; 0.0; 1.0; 0.0; 0.0 +1378178327; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378178627; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378178927; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1378179227; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378179527; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 144003.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378179828; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106253.86666666667; 0.0; 1.0; 0.0; 0.0 +1378180128; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 90874.66666666667; 0.0; 7.8; 0.2; 0.13333333333333333 +1378180428; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 85282.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378180728; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 95069.06666666667; 0.0; 1.6; 0.0; 0.0 +1378181028; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378181328; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 110448.53333333334; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378181628; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 138411.2; 0.0; 1.2; 0.0; 0.0 +1378181928; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378182228; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 81087.73333333334; 0.0; 1.0; 0.0; 0.0 +1378182528; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 125828.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378182828; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378183128; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1378183428; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378183728; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378184028; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378184328; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1378184628; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 93670.93333333333; 0.0; 1.2; 0.0; 0.0 +1378184928; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 145401.33333333334; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1378185228; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 177556.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378185528; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1378185828; 1; 2599.999343; 69.33331581333334; 2.666666666666667; 2097152.0; 619357.0666666667; 161.0; 22.0; 0.06666666666666667; 0.4 +1378186128; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 404049.3333333333; 0.0; 2.7333333333333334; 0.0; 0.0 +1378186428; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 234879.73333333334; 31.8; 14.466666666666667; 0.0; 0.0 +1378186728; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 190140.0; 0.0; 8.866666666666667; 0.2; 0.13333333333333333 +1378187028; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 178955.46666666667; 0.0; 1.6666666666666667; 0.0; 0.0 +1378187328; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 141207.46666666667; 0.0; 1.2; 0.0; 0.0 +1378187628; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 123031.73333333334; 0.0; 0.8; 0.0; 0.0 +1378187928; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1378188228; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 157985.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1378188529; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 116041.06666666667; 0.4; 2.8; 0.06666666666666667; 0.5333333333333333 +1378188829; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 139808.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378189129; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378189429; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378189729; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378190029; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 146799.73333333334; 0.0; 2.3333333333333335; 0.06666666666666667; 0.06666666666666667 +1378190329; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 138410.66666666666; 0.0; 1.7333333333333334; 0.0; 0.0 +1378190629; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378190929; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 153789.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378191229; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378191529; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378191829; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 134216.8; 0.0; 0.8; 0.0; 0.0 +1378192129; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 139808.26666666666; 0.06666666666666667; 2.4; 0.06666666666666667; 0.5333333333333333 +1378192429; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 145401.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378192729; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 157984.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378193029; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1378193329; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 114642.93333333333; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1378193629; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378193929; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 135614.13333333333; 12.733333333333333; 13.666666666666666; 0.3333333333333333; 0.13333333333333333 +1378194229; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.6; 0.13333333333333333; 0.0 +1378194529; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 1.2; 0.06666666666666667; 0.0 +1378194829; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378195129; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 0.8; 0.06666666666666667; 0.0 +1378195429; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378195729; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 120235.46666666666; 0.06666666666666667; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1378196029; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378196329; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 145401.06666666668; 0.0; 0.8; 0.0; 0.0 +1378196629; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378196929; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1378197229; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378197529; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378197829; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378198129; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 128624.26666666666; 0.0; 1.0; 0.0; 0.0 +1378198429; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378198730; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378199030; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 113244.8; 0.0; 1.3333333333333333; 0.0; 0.0 +1378199330; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 146800.0; 0.0; 2.466666666666667; 0.06666666666666667; 0.5333333333333333 +1378199630; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 116041.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378199930; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378200230; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 7.0; 0.26666666666666666; 0.13333333333333333 +1378200530; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378200830; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378201130; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 103457.86666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1378201430; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1378201730; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120234.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378202030; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1378202330; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378202630; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378202930; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 111846.4; 0.0; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1378203230; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 124429.33333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378203530; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378203830; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 137012.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378204130; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378204430; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378204730; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 131419.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378205030; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378205330; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 123031.73333333334; 0.0; 1.2; 0.0; 0.0 +1378205630; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1378205930; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378206230; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378206530; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 110448.26666666666; 0.0; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1378206831; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 141206.93333333332; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1378207131; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 103457.86666666667; 1.3333333333333333; 6.133333333333334; 0.0; 0.0 +1378207431; 1; 2599.999343; 32.93332501133333; 1.2666666666666666; 2097152.0; 171964.8; 21.6; 7.2; 0.06666666666666667; 0.0 +1378207731; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378208031; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 141207.46666666667; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1378208331; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378208631; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378208931; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 135614.93333333332; 0.0; 1.1333333333333333; 0.0; 0.0 +1378209231; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378209531; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 132818.66666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378209831; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1378210131; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 150992.8; 0.06666666666666667; 2.6; 0.06666666666666667; 0.5333333333333333 +1378210431; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 174761.06666666668; 0.0; 1.0; 0.0; 0.0 +1378210731; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 1.2; 0.13333333333333333; 0.0 +1378211031; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378211331; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378211631; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 130021.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378211931; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 146799.46666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1378212231; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 102059.73333333334; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378212531; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378212831; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 135614.13333333333; 0.06666666666666667; 7.133333333333334; 0.2; 0.13333333333333333 +1378213131; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378213431; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378213731; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 137012.0; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378214031; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 148197.6; 0.0; 1.0; 0.0; 0.0 +1378214331; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378214631; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1378214931; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 83884.0; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378215231; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378215531; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378215831; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378216131; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378216431; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1378216731; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.2; 0.0 +1378217031; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 131420.26666666666; 0.0; 1.0; 0.0; 0.0 +1378217331; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 152392.0; 0.0; 2.4; 0.06666666666666667; 0.5333333333333333 +1378217631; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 162178.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378217932; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378218232; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1378218532; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378218832; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.06666666666666667; 0.13333333333333333 +1378219132; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 127226.13333333333; 0.0; 6.466666666666667; 0.2; 0.13333333333333333 +1378219432; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 1.6666666666666667; 0.0; 0.0 +1378219732; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 141207.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378220032; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378220332; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1378220632; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1378220932; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 118836.53333333334; 0.0; 2.2; 0.06666666666666667; 0.5333333333333333 +1378221232; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 176159.2; 0.0; 1.0; 0.2; 0.0 +1378221532; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378221832; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 130022.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378222132; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 82485.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378222432; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 137013.06666666668; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378222732; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378223032; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378223332; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378223632; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 127225.33333333333; 0.0; 1.0; 0.0; 0.0 +1378223932; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378224232; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378224532; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 121633.6; 0.26666666666666666; 2.8; 0.06666666666666667; 0.4666666666666667 +1378224832; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 125828.0; 0.0; 0.8; 0.4666666666666667; 0.0 +1378225132; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378225432; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.6666666666666667; 0.06666666666666667; 0.0 +1378225732; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 5.866666666666666; 0.26666666666666666; 0.13333333333333333 +1378226032; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 121633.6; 0.0; 2.4; 0.3333333333333333; 0.0 +1378226332; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378226632; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1378226932; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1378227232; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378227533; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 76893.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378227833; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1378228133; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 116041.06666666667; 0.06666666666666667; 2.3333333333333335; 0.0; 0.4666666666666667 +1378228433; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 138410.4; 0.0; 1.0; 0.0; 0.0 +1378228733; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.4; 0.0; 0.0 +1378229033; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378229333; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378229633; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1378229933; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378230233; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 12.066666666666666; 0.0; 0.0 +1378230533; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378230833; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1378231133; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378231433; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1378231733; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 139808.53333333333; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378232033; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 164974.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1378232333; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378232633; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378232933; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 155188.0; 0.0; 7.333333333333333; 0.26666666666666666; 0.13333333333333333 +1378233233; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378233533; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1378233833; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378234133; 1; 2599.999343; 71.06664870866665; 2.733333333333333; 2097152.0; 789924.8; 161.06666666666666; 22.2; 0.06666666666666667; 0.4 +1378234433; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 331348.0; 0.0; 2.933333333333333; 0.0; 0.0 +1378234733; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 188741.6; 31.8; 3.466666666666667; 0.0; 0.0 +1378235033; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 150993.6; 0.8; 2.3333333333333335; 0.06666666666666667; 0.0 +1378235333; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 188741.6; 0.06666666666666667; 3.466666666666667; 0.13333333333333333; 0.5333333333333333 +1378235633; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 159382.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378235933; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378236233; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378236533; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378236834; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378237134; 1; 2599.999343; 46.799988174; 1.8; 2097152.0; 208315.73333333334; 161.8; 14.8; 0.0; 0.13333333333333333 +1378237434; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 469760.0; 0.0; 1.3333333333333333; 0.0; 0.0 +1378237734; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 191538.4; 31.8; 4.066666666666666; 0.0; 0.0 +1378238034; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 213908.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378238334; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378238634; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 121633.6; 0.0; 7.0; 0.2; 0.13333333333333333 +1378238934; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 146798.4; 0.0; 2.066666666666667; 0.06666666666666667; 0.5333333333333333 +1378239234; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 163576.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378239534; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378239834; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378240134; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378240434; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 127226.13333333333; 0.0; 1.0; 0.0; 0.0 +1378240734; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 138411.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378241034; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378241334; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 134216.0; 0.0; 1.0; 0.0; 0.0 +1378241634; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378241934; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378242234; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378242534; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 130021.6; 0.0; 2.6; 0.0; 0.5333333333333333 +1378242834; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378243134; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 113244.0; 0.0; 0.8; 0.0; 0.0 +1378243434; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1378243734; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 118836.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378244034; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378244334; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378244634; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 7.2; 0.2; 0.13333333333333333 +1378244934; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 142604.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378245234; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 128624.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378245534; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 144002.93333333332; 0.0; 0.8; 0.0; 0.0 +1378245834; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378246134; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 110448.53333333334; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378246434; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 116041.06666666667; 0.0; 1.0; 0.0; 0.0 +1378246734; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378247034; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378247334; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378247634; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 132817.86666666667; 0.06666666666666667; 1.5333333333333334; 0.0; 0.06666666666666667 +1378247935; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378248235; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 138411.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378248535; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378248835; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378249135; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378249435; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 124429.86666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1378249735; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 139809.33333333334; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1378250035; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 134216.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378250335; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378250635; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1378250935; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 103457.86666666667; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1378251235; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 148198.13333333333; 0.0; 2.066666666666667; 0.0; 0.0 +1378251536; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 89476.53333333334; 0.0; 1.2; 0.0; 0.0 +1378251836; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378252136; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.6; 0.0; 0.0 +1378252436; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1378252736; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378253036; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378253336; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 121633.6; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1378253636; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 163576.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1378253936; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 150994.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378254236; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378254536; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378254836; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 114642.93333333333; 0.5333333333333333; 1.4666666666666666; 0.0; 0.0 +1378255136; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378255436; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378255736; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1378256036; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378256336; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 92272.8; 0.0; 1.2666666666666666; 0.0; 0.0 +1378256636; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378256936; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 176159.2; 0.2; 2.533333333333333; 0.0; 0.5333333333333333 +1378257236; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 150992.8; 0.06666666666666667; 1.0; 0.0; 0.0 +1378257536; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 83884.0; 0.0; 1.0; 0.0; 0.0 +1378257836; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 12.8; 13.0; 0.4; 0.13333333333333333 +1378258136; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378258436; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 152391.73333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1378258736; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1378259036; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1378259336; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378259636; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1378259936; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378260236; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 131419.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378260537; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 157983.46666666667; 0.0; 2.6; 0.0; 0.5333333333333333 +1378260837; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 139808.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378261137; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 166373.06666666668; 0.0; 0.9333333333333333; 0.0; 0.0 +1378261437; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378261737; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378262037; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378262337; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378262637; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378262937; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117438.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378263237; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 132817.86666666667; 0.0; 1.2; 0.0; 0.0 +1378263537; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 110447.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378263837; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1378264137; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 138410.4; 0.0; 2.2; 0.0; 0.4666666666666667 +1378264437; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 148197.33333333334; 0.0; 6.733333333333333; 0.2; 0.13333333333333333 +1378264737; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 163577.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378265037; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130022.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378265337; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378265637; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 1.0; 0.0; 0.0 +1378265937; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378266237; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1378266537; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378266837; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378267137; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 83884.0; 0.0; 0.8; 0.06666666666666667; 0.0 +1378267437; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 104856.0; 1.4666666666666666; 1.4; 0.0; 0.0 +1378267737; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 141206.66666666666; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1378268037; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378268338; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1378268638; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378268938; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378269238; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378269538; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1378269838; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.7333333333333334; 0.0; 0.0 +1378270138; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 96467.2; 0.0; 1.2; 0.0; 0.0 +1378270438; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 146799.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378270738; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 142604.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1378271038; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378271338; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 166372.26666666666; 0.06666666666666667; 2.6; 0.0; 0.5333333333333333 +1378271638; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 139809.33333333334; 0.0; 7.0; 0.26666666666666666; 0.2 +1378271938; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 146800.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1378272238; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1378272538; 1; 2599.999343; 5.199998686; 0.2; 2097152.0; 121633.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1378272838; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378273138; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 135614.93333333332; 0.0; 0.6; 0.0; 0.0 +1378273438; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1378273738; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 100661.6; 0.0; 11.666666666666666; 0.06666666666666667; 0.0 +1378274038; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378274338; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378274638; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1378274938; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 121633.6; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1378275238; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 155188.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378275538; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1378275838; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378276138; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 74097.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378276438; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 117439.2; 0.0; 2.4; 0.06666666666666667; 0.13333333333333333 +1378276738; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 144002.93333333332; 0.0; 1.5333333333333334; 0.0; 0.0 +1378277038; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 1.4666666666666666; 0.06666666666666667; 0.0 +1378277338; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378277638; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 99263.46666666666; 0.0; 6.933333333333334; 0.4666666666666667; 0.13333333333333333 +1378277938; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378278238; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378278538; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 156586.93333333332; 0.0; 2.6; 0.0; 0.5333333333333333 +1378278838; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 156584.8; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378279138; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.26666666666666666; 0.0 +1378279438; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 124428.8; 0.0; 1.0; 0.0; 0.0 +1378279738; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 100661.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1378280038; 1; 2599.999343; 32.93332501133333; 1.2666666666666666; 2097152.0; 164974.66666666666; 161.13333333333333; 20.4; 0.06666666666666667; 0.4 +1378280338; 1; 2599.999343; 53.733319755333326; 2.0666666666666664; 2097152.0; 759166.4; 0.0; 3.6666666666666665; 0.0; 0.0 +1378280638; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 314570.4; 31.8; 3.7333333333333334; 0.0; 0.0 +1378280938; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 204119.46666666667; 0.0; 2.8; 0.0; 0.0 +1378281238; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 183149.06666666668; 0.0; 2.066666666666667; 0.0; 0.0 +1378281538; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 148197.86666666667; 0.0; 1.0; 0.0; 0.0 +1378281838; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.13333333333333333; 0.0 +1378282138; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 163575.73333333334; 0.06666666666666667; 2.533333333333333; 0.0; 0.5333333333333333 +1378282438; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 170566.66666666666; 0.0; 1.2; 0.0; 0.0 +1378282739; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378283039; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378283339; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378283639; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378283939; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 121633.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1378284239; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1378284539; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 135614.93333333332; 0.06666666666666667; 7.133333333333334; 0.2; 0.13333333333333333 +1378284839; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 116040.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378285139; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378285439; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378285739; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 107652.26666666666; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1378286039; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 142605.06666666668; 0.0; 1.0; 0.0; 0.0 +1378286339; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 139809.06666666668; 0.0; 1.0; 0.0; 0.0 +1378286639; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 116041.06666666667; 0.0; 1.2; 0.0; 0.0 +1378286939; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378287239; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378287539; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378287839; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378288139; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 137013.06666666668; 20.4; 2.3333333333333335; 0.0; 0.06666666666666667 +1378288439; 1; 2599.999343; 29.466659220666667; 1.1333333333333333; 2097152.0; 135614.93333333332; 0.0; 3.933333333333333; 0.0; 0.0 +1378288739; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 127226.13333333333; 0.0; 2.466666666666667; 0.0; 0.0 +1378289039; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 152390.93333333332; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378289340; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 144003.73333333334; 0.06666666666666667; 2.7333333333333334; 0.0; 0.4666666666666667 +1378289640; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 166372.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378289940; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1378290240; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 160780.53333333333; 0.0; 1.0; 0.0; 0.0 +1378290540; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1378290840; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 90874.66666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1378291140; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378291440; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378291740; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378292040; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378292340; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378292640; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 130021.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378292940; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.06666666667; 0.13333333333333333; 2.6666666666666665; 0.06666666666666667; 0.5333333333333333 +1378293240; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 174760.8; 0.0; 1.0; 0.0; 0.0 +1378293540; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378293840; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378294140; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378294440; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378294740; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378295040; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378295340; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 132818.66666666666; 0.0; 1.2; 0.0; 0.0 +1378295640; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378295940; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 114642.93333333333; 0.0; 0.8; 0.0; 0.0 +1378296240; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 156585.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378296540; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 191538.13333333333; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.5333333333333333 +1378296840; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 194334.66666666666; 0.0; 6.733333333333333; 0.2; 0.13333333333333333 +1378297140; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 181751.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378297441; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378297741; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1378298041; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378298341; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1378298641; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378298941; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109049.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378299241; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378299541; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378299841; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 160780.0; 0.0; 1.0; 0.0; 0.0 +1378300141; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 162177.86666666667; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378300441; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 159382.4; 0.0; 1.2; 0.0; 0.0 +1378300741; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378301041; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 148198.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378301341; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378301641; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 102059.73333333334; 0.9333333333333333; 1.7333333333333334; 0.0; 0.0 +1378301941; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 93670.93333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1378302241; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378302541; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 141207.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378302841; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378303141; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378303441; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 111846.66666666667; 0.0; 7.466666666666667; 0.2; 0.13333333333333333 +1378303741; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 160780.0; 0.0; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1378304041; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 174760.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378304341; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378304642; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 81087.73333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1378304942; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378305242; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 177557.06666666668; 0.2; 1.2; 0.06666666666666667; 0.13333333333333333 +1378305542; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378305842; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378306142; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.2; 0.0; 0.0 +1378306442; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1378306742; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378307042; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 149595.46666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1378307342; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 138410.13333333333; 0.0; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1378307641; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 150993.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378307941; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1378308241; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378308541; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378308841; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 135614.93333333332; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378309141; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 141207.46666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1378309441; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.2; 0.0 +1378309741; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 148198.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378310041; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378310341; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 114642.93333333333; 0.0; 7.133333333333334; 0.4; 0.13333333333333333 +1378310641; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378310941; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.0; 2.466666666666667; 0.8666666666666667; 0.5333333333333333 +1378311241; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 127225.33333333333; 0.0; 1.0; 0.0; 0.0 +1378311541; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.2; 0.0; 0.0 +1378311842; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1378312142; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 134216.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378312442; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378312742; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378313042; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 141207.46666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378313342; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1378313642; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378313942; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378314242; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 114642.93333333333; 0.0; 1.8666666666666667; 0.0; 0.0 +1378314542; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 150993.86666666667; 0.0; 2.466666666666667; 0.06666666666666667; 0.5333333333333333 +1378314842; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 174760.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378315142; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378315442; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 86680.26666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378315742; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 86680.26666666666; 12.733333333333333; 13.533333333333333; 0.4666666666666667; 0.2 +1378316042; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 118837.33333333333; 0.0; 1.4666666666666666; 0.06666666666666667; 0.0 +1378316342; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 93670.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378316642; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378316942; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.8666666666666667; 0.0 +1378317242; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 104855.2; 0.0; 11.866666666666667; 0.2; 0.0 +1378317542; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378317842; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 92272.8; 0.0; 1.4666666666666666; 0.0; 0.0 +1378318142; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 130022.13333333333; 0.06666666666666667; 2.7333333333333334; 0.06666666666666667; 0.5333333333333333 +1378318442; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 138410.66666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378318742; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378319042; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378319342; 1; 2599.999343; 6.933331581333333; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378319642; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 120235.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1378319942; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 148197.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378320243; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378320543; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378320843; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.06666666666666667; 0.0 +1378321143; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.6; 0.0; 0.0 +1378321443; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1378321743; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 144003.73333333334; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.5333333333333333 +1378322043; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 178955.46666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378322343; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 120235.46666666666; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1378322643; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 148197.33333333334; 0.0; 1.2; 0.0; 0.0 +1378322943; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1378323243; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378323543; 1; 2599.999343; 39.866656592666665; 1.5333333333333334; 2097152.0; 160779.73333333334; 161.0; 14.4; 0.0; 0.2 +1378323843; 1; 2599.999343; 27.733326325333334; 1.0666666666666667; 2097152.0; 443195.73333333334; 0.0; 1.5333333333333334; 0.0; 0.0 +1378324143; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 184547.2; 31.8; 4.066666666666666; 0.0; 0.0 +1378324443; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 192936.26666666666; 0.0; 1.0; 0.0; 0.0 +1378324743; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 120234.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378325043; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378325343; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 121632.8; 0.06666666666666667; 2.4; 0.06666666666666667; 0.5333333333333333 +1378325643; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 123030.93333333333; 0.0; 1.2; 0.0; 0.0 +1378325943; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378326243; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1378326543; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378326843; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 124429.86666666667; 0.0; 1.2; 0.0; 0.0 +1378327143; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378327443; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378327743; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378328043; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 123031.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378328343; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 1.3333333333333333; 0.0; 0.0 +1378328643; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 114642.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378328943; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 159381.6; 0.06666666666666667; 2.4; 0.06666666666666667; 0.5333333333333333 +1378329244; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 190139.46666666667; 0.0; 7.933333333333334; 0.2; 0.13333333333333333 +1378329544; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 153790.13333333333; 0.0; 1.2; 0.0; 0.0 +1378329844; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1378330144; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 82485.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378330444; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1378330744; 1; 2599.999343; 8.666664476666668; 0.33333333333333337; 2097152.0; 149595.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378331044; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378331344; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378331644; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378331944; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378332244; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378332544; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 127225.86666666667; 0.06666666666666667; 2.8; 0.06666666666666667; 0.5333333333333333 +1378332844; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 103457.33333333333; 0.0; 1.0; 0.0; 0.0 +1378333144; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378333444; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 131420.53333333333; 0.0; 0.8; 0.0; 0.0 +1378333744; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378334044; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 99263.46666666666; 0.0; 1.5333333333333334; 0.06666666666666667; 0.13333333333333333 +1378334344; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 132817.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378334644; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 110448.53333333334; 0.0; 7.2; 0.2; 0.13333333333333333 +1378334944; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 145401.06666666668; 0.0; 1.0666666666666667; 0.0; 0.0 +1378335244; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 169169.06666666668; 0.0; 1.1333333333333333; 0.0; 0.0 +1378335544; 1; 2599.999343; 65.86665002266666; 2.533333333333333; 2097152.0; 485139.4666666667; 161.0; 21.333333333333332; 0.06666666666666667; 0.4 +1378335844; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 588599.4666666667; 1.0666666666666667; 3.066666666666667; 0.0; 0.0 +1378336144; 1; 2599.999343; 24.266660534666663; 0.9333333333333332; 2097152.0; 306181.86666666664; 32.666666666666664; 5.6; 0.06666666666666667; 0.4666666666666667 +1378336444; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 236276.53333333333; 0.0; 2.466666666666667; 0.0; 0.0 +1378336744; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 169169.6; 0.0; 1.6666666666666667; 0.0; 0.0 +1378337045; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 110448.53333333334; 0.06666666666666667; 0.8666666666666667; 0.0; 0.0 +1378337345; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 95069.06666666667; 3.8; 1.4; 0.0; 0.0 +1378337645; 1; 2599.999343; 22.533327639333333; 0.8666666666666667; 2097152.0; 156586.13333333333; 0.4; 3.2666666666666666; 0.0; 0.0 +1378337945; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 128624.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378338245; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378338545; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378338845; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378339145; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378339445; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378339745; 1; 2599.999343; 20.799994744; 0.8; 2097152.0; 118837.33333333333; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.5333333333333333 +1378340045; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 135614.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1378340345; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 128623.46666666666; 0.0; 0.8; 0.0; 0.0 +1378340645; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 81087.73333333334; 0.0; 1.0; 0.0; 0.0 +1378340945; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 72698.93333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1378341245; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 107652.26666666666; 0.6; 7.333333333333333; 0.2; 0.13333333333333333 +1378341545; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378341845; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1378342145; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 75495.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378342445; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.0; 0.0; 0.0 +1378342745; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378343045; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1378343345; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 153789.86666666667; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378343645; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 152391.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378343945; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 152391.73333333334; 0.0; 1.0; 0.0; 0.0 +1378344245; 1; 2599.999343; 17.333328953333336; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378344545; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1378344845; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 121633.6; 0.06666666666666667; 1.4666666666666666; 0.0; 0.0 +1378345145; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378345445; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.06666666666666667; 0.0 +1378345745; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 130022.4; 0.0; 1.0; 0.0; 0.0 +1378346045; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378346345; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 88078.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378346645; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378346945; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 137012.26666666666; 0.06666666666666667; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1378347245; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 163576.0; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378347545; 1; 2599.999343; 19.066661848666666; 0.7333333333333333; 2097152.0; 120235.46666666666; 0.0; 7.466666666666667; 0.3333333333333333; 0.13333333333333333 +1378347845; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 123030.93333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378348145; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 144002.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1378348445; 1; 2599.999343; 10.399997372; 0.4; 2097152.0; 142604.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378348745; 1; 2599.999343; 12.133330267333331; 0.4666666666666666; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378349045; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 134216.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378349345; 1; 2599.999343; 15.599996057999999; 0.6; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1378349645; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 144003.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378349945; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378350245; 1; 2599.999343; 13.866663162666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378350545; 1; 2599.999601; 25.99999601; 1.0; 2097152.0; 167772.0; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378350845; 1; 2599.999601; 19.066663740666666; 0.7333333333333333; 2097152.0; 167772.0; 0.0; 1.1333333333333333; 0.2; 0.0 +1378351145; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378351445; 1; 2599.999601; 6.9333322693333335; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378351745; 1; 2599.999601; 12.133331471333332; 0.4666666666666666; 2097152.0; 75495.2; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378352046; 1; 2599.999601; 10.399998404; 0.4; 2097152.0; 103457.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378352346; 1; 2599.999601; 6.9333322693333335; 0.26666666666666666; 2097152.0; 109049.86666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378352646; 1; 2599.999601; 10.399998404; 0.4; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378352946; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.4666666666666666; 0.0; 0.0 +1378353246; 1; 2599.999601; 8.666665336666668; 0.33333333333333337; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378353546; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1378353846; 1; 2599.999601; 8.666665336666668; 0.33333333333333337; 2097152.0; 95069.06666666667; 0.06666666666666667; 6.533333333333333; 0.26666666666666666; 0.13333333333333333 +1378354146; 1; 2599.999601; 13.866664538666667; 0.5333333333333333; 2097152.0; 180353.6; 0.0; 2.6666666666666665; 0.06666666666666667; 0.4666666666666667 +1378354446; 1; 2599.999601; 10.399998404; 0.4; 2097152.0; 125827.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378354746; 1; 2599.999601; 0.0; 0.0; 2097152.0; 150993.6; 0.0; 1.0; 0.0; 0.0 +1378355046; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 148198.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378355346; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378355646; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378355946; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 1.4; 0.0; 0.0 +1378356246; 1; 2599.999601; 0.0; 0.0; 2097152.0; 127225.33333333333; 0.0; 1.0; 0.0; 0.0 +1378356546; 1; 2599.999601; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378356846; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378357146; 1; 2599.999601; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378357446; 1; 2599.999601; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1378357746; 1; 2599.999601; 8.666665336666668; 0.33333333333333337; 2097152.0; 142605.6; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378358046; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 134216.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378358346; 1; 2599.999601; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378358646; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378358947; 1; 2599.999601; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.6666666666666667; 0.0; 0.0 +1378359247; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 127226.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378359547; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 1.0; 0.0; 0.0 +1378359847; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 6.933333333333334; 0.26666666666666666; 0.13333333333333333 +1378360147; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1378360447; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378360747; 1; 2599.999601; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378361047; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 123031.73333333334; 0.0; 11.866666666666667; 0.0; 0.0 +1378361347; 1; 2599.999601; 8.666665336666668; 0.33333333333333337; 2097152.0; 155186.93333333332; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1378361647; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 171965.6; 0.0; 0.8666666666666667; 4.4; 0.0 +1378361947; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 162177.6; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378362247; 1; 2599.999601; 0.0; 0.0; 2097152.0; 121632.8; 0.0; 1.2; 0.26666666666666666; 0.0 +1378362547; 1; 2599.999601; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378362847; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 173362.13333333333; 0.06666666666666667; 2.8666666666666667; 0.13333333333333333; 0.13333333333333333 +1378363147; 1; 2599.999601; 0.0; 0.0; 2097152.0; 184547.2; 0.0; 1.7333333333333334; 0.0; 0.0 +1378363447; 1; 2599.999601; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378363747; 1; 2599.999601; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378364047; 1; 2599.999601; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378364347; 1; 2599.999601; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378364647; 1; 2599.999601; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378364947; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 149595.46666666667; 0.26666666666666666; 2.4; 0.06666666666666667; 0.5333333333333333 +1378365247; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 180352.8; 0.0; 1.0; 0.0; 0.0 +1378365547; 1; 2599.999601; 6.9333322693333335; 0.26666666666666666; 2097152.0; 134216.8; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1378365847; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378366147; 1; 2599.999601; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378366447; 1; 2599.999601; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378366747; 1; 2599.999601; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378367047; 1; 2599.999601; 0.0; 0.0; 2097152.0; 155188.0; 0.0; 1.7333333333333334; 0.0; 0.0 +1378367347; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 1.0; 0.2; 0.0 +1378367647; 1; 2599.999601; 0.0; 0.0; 2097152.0; 128623.46666666666; 0.0; 1.0; 0.0; 0.0 +1378367947; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378368247; 1; 2599.999601; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378368547; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 146799.2; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378368848; 1; 2599.999601; 0.0; 0.0; 2097152.0; 150992.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378369148; 1; 2599.999601; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378369448; 1; 2599.999601; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378369748; 1; 2599.999601; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1378370048; 1; 2599.999601; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378370348; 1; 2599.999601; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1378370648; 1; 2599.999601; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378370948; 1; 2599.999601; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378371248; 1; 2599.999601; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378371548; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378371848; 1; 2599.999601; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378372148; 1; 2599.999601; 10.399998404; 0.4; 2097152.0; 141206.66666666666; 0.0; 8.2; 0.26666666666666666; 0.6666666666666666 +1378372448; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 155187.2; 0.0; 1.2; 0.0; 0.0 +1378372748; 1; 2599.999601; 0.0; 0.0; 2097152.0; 150994.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378373047; 1; 2599.999601; 0.0; 0.0; 2097152.0; 150993.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1378373347; 1; 2599.999601; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1378373647; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378373947; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 96467.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1378374247; 1; 2599.999601; 8.666665336666668; 0.33333333333333337; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378374547; 1; 2599.999601; 15.599997605999999; 0.6; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378374847; 1; 2599.999601; 17.333330673333336; 0.6666666666666667; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378375147; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378375447; 1; 2599.999601; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.8; 0.0; 0.0 +1378375747; 1; 2599.999601; 5.199999202; 0.2; 2097152.0; 117439.2; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1378376047; 1; 2599.999601; 3.4666661346666667; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378376347; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1378376648; 1; 2599.999601; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1378376948; 1; 2599.999601; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378377248; 1; 2599.999601; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1378377548; 1; 2599.999601; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1378377848; 1; 2599.999601; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378378148; 1; 2599.999601; 0.0; 0.0; 2097152.0; 152391.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378378448; 1; 2599.999601; 0.0; 0.0; 2097152.0; 148197.33333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378378748; 1; 2599.999601; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378379048; 1; 2599.999601; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378379348; 1; 2599.999601; 10.399998404; 0.4; 2097152.0; 142605.6; 13.0; 18.6; 0.3333333333333333; 0.6 +1378379648; 1; 2599.999601; 10.399998404; 0.4; 2097152.0; 130021.6; 0.0; 1.2; 0.0; 0.0 +1378379948; 1; 2599.999601; 13.866664538666667; 0.5333333333333333; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1378380248; 1; 2599.999601; 17.333330673333336; 0.6666666666666667; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1378380548; 1; 2599.999601; 0.0; 0.0; 2097152.0; 109049.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1378380848; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 54523.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378381148; 1; 2599.999601; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.0; 0.0 +1378381448; 1; 2599.999601; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.4; 0.0; 0.0 +1378381748; 1; 2599.999601; 1.7333330673333334; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378382048; 1; 2599.999601; 13.866664538666667; 0.5333333333333333; 2097152.0; 134216.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378382348; 1; 2599.999601; 6.9333322693333335; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1378382648; 1; 2599.999601; 17.333330673333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1378382948; 1; 2599.999601; 15.599997605999999; 0.6; 2097152.0; 155187.2; 0.06666666666666667; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1378383248; 1; 2599.999601; 0.0; 0.0; 2097152.0; 150992.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378383548; 1; 2599.999601; 0.0; 0.0; 2097152.0; 141206.66666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378383848; 1; 2599.999601; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378384149; 1; 2599.999601; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378384449; 1; 2599.998989; 51.999979780000004; 2.0; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378384749; 1; 2599.998989; 22.53332457133334; 0.8666666666666667; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1378385049; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378385349; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378385649; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 139809.33333333334; 0.0; 6.933333333333334; 0.26666666666666666; 0.2 +1378385949; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1378386249; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378386549; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 124429.6; 0.0; 2.533333333333333; 0.13333333333333333; 0.5333333333333333 +1378386849; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 159381.86666666667; 0.0; 0.8; 0.0; 0.0 +1378387149; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 92272.8; 0.0; 0.6666666666666666; 0.13333333333333333; 0.0 +1378387449; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378387749; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378388049; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1378388349; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 118837.33333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1378388649; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1378388949; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378389249; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1378389549; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 109050.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1378389849; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378390149; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 138410.4; 0.2; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1378390449; 1; 2599.998989; 74.53330435133334; 2.8666666666666667; 2097152.0; 250258.93333333332; 161.0; 21.8; 0.06666666666666667; 0.3333333333333333 +1378390749; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 717224.5333333333; 0.0; 2.533333333333333; 0.06666666666666667; 0.0 +1378391049; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 359310.13333333336; 31.8; 3.6; 0.0; 0.0 +1378391949; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 145401.86666666667; 0.0; 1.0; 0.0; 0.0 +1378392249; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 130022.4; 0.0; 6.4; 0.2; 0.13333333333333333 +1378392549; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 118837.33333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1378392849; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.2; 0.0 +1378393149; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 79689.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378393449; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378393749; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 181751.46666666667; 0.0; 2.2; 0.06666666666666667; 0.4666666666666667 +1378394050; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 149595.73333333334; 0.0; 0.6; 0.06666666666666667; 0.0 +1378394350; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 138410.4; 0.0; 0.8; 0.0; 0.0 +1378394650; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 145401.06666666668; 0.0; 1.2; 0.0; 0.0 +1378394950; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.8; 0.06666666666666667; 0.0 +1378395250; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 96467.2; 0.0; 0.6666666666666666; 0.0; 0.0 +1378395550; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1378395850; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 118837.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378396150; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 127226.13333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1378396450; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 127225.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378396750; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378397050; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 142605.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378397350; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 131420.53333333333; 0.0; 2.7333333333333334; 0.13333333333333333; 0.5333333333333333 +1378397650; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 149595.46666666667; 0.0; 0.8; 0.0; 0.0 +1378397950; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378398250; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378398550; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 144003.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378398850; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 125828.0; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378399150; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 120234.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378399450; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 116041.06666666667; 0.0; 7.0; 0.26666666666666666; 0.13333333333333333 +1378399750; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 113244.8; 0.0; 1.0; 0.13333333333333333; 0.0 +1378400050; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378400350; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378400650; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378400950; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 125827.2; 0.06666666666666667; 2.533333333333333; 0.0; 0.4666666666666667 +1378401250; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 150994.4; 0.0; 1.0; 0.0; 0.0 +1378401550; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 1.2; 0.0; 0.0 +1378401850; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378402150; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378402450; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378402750; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378403050; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1378403350; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 1.7333333333333334; 0.0; 0.0 +1378403650; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378403951; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378404251; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 117439.2; 0.0; 1.6; 0.0; 0.0 +1378404551; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 146798.4; 0.0; 13.0; 0.06666666666666667; 0.4666666666666667 +1378404851; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 178954.66666666666; 0.0; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1378405151; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 163575.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378405451; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378405750; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 138411.2; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378406050; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378406350; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378406650; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378406950; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378407250; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378407550; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378407850; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378408150; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 164974.13333333333; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1378408450; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 146799.2; 0.0; 1.3333333333333333; 0.0; 0.0 +1378408751; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378409051; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378409351; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378409651; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378409951; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378410251; 1; 2599.998989; 51.999979780000004; 2.0; 2097152.0; 591395.2; 161.73333333333332; 14.2; 0.0; 0.2 +1378410551; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 272627.2; 0.0; 1.5333333333333334; 0.0; 0.0 +1378410851; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 159383.2; 31.8; 3.533333333333333; 0.0; 0.0 +1378411151; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 127226.13333333333; 0.0; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1378411451; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 4.466666666666667; 0.0 +1378411751; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 159382.4; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1378412051; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 159382.4; 0.0; 0.8; 0.0; 0.0 +1378412351; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378412651; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378412951; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1378413251; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 159382.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378413551; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1378413851; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 130022.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378414151; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378414451; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 113244.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1378414751; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378415051; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378415351; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.13333333333333333; 2.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1378415651; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 134216.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378415951; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378416251; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 125827.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378416551; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378416851; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 125827.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378417152; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 85282.13333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378417452; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1378417752; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 78291.46666666666; 0.0; 7.333333333333333; 0.26666666666666666; 0.2 +1378418052; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378418352; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 71300.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378418652; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1378418952; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 127226.13333333333; 0.06666666666666667; 2.1333333333333333; 0.0; 0.4666666666666667 +1378419252; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 138411.2; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378419552; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378419852; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378420152; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 135614.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378420452; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 125827.2; 0.0; 1.6; 0.06666666666666667; 0.13333333333333333 +1378420752; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378421052; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 102059.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378421352; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378421652; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378421952; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 74097.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378422252; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 1.2; 0.0; 0.0 +1378422552; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 144002.93333333332; 0.06666666666666667; 2.6; 0.06666666666666667; 0.4666666666666667 +1378422852; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 135614.93333333332; 0.0; 1.0666666666666667; 0.0; 0.0 +1378423152; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378423452; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378423752; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378424052; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 134216.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378424352; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378424653; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 117439.2; 0.06666666666666667; 6.333333333333333; 0.2; 0.13333333333333333 +1378424953; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 132818.66666666666; 0.0; 2.1333333333333333; 0.0; 0.0 +1378425253; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378425553; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378425853; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378426153; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 110448.53333333334; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378426453; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 132817.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378426753; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378427053; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378427353; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378427653; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 146799.2; 0.5333333333333333; 1.4; 0.0; 0.0 +1378427953; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 116041.06666666667; 0.0; 1.4; 0.0; 0.0 +1378428253; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378428553; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378428853; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378429153; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 150994.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378429453; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 138410.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378429753; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 131420.53333333333; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1378430053; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 162178.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378430353; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 120235.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378430653; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378430953; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378431253; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 6.933333333333334; 0.26666666666666666; 0.13333333333333333 +1378431553; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378431853; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378432153; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378432453; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378432753; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378433054; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1378433354; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 118836.8; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1378433654; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 135614.66666666666; 0.0; 1.6666666666666667; 0.0; 0.0 +1378433954; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 167770.4; 0.0; 1.2; 0.0; 0.0 +1378434254; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 123030.93333333333; 0.0; 1.0; 0.0; 0.0 +1378434554; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1378434854; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378435154; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378435454; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378435754; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378436054; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.0; 1.2; 0.0; 0.0 +1378436354; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 134216.0; 0.0; 1.0; 0.0; 0.0 +1378436654; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378436954; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 157983.73333333334; 0.4; 2.1333333333333333; 0.06666666666666667; 0.4666666666666667 +1378437254; 1; 2599.998989; 22.53332457133334; 0.8666666666666667; 2097152.0; 208316.0; 12.733333333333333; 13.2; 0.3333333333333333; 0.13333333333333333 +1378437554; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 139808.53333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378437854; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1378438154; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1378438454; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378438754; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378439053; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 81087.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378439354; 1; 2599.998989; 69.33330637333334; 2.666666666666667; 2097152.0; 310376.8; 161.0; 22.266666666666666; 0.06666666666666667; 0.3333333333333333 +1378439654; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 666892.2666666667; 0.0; 2.466666666666667; 0.0; 0.0 +1378439954; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 279618.4; 31.8; 3.533333333333333; 0.0; 0.0 +1378440254; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 194334.66666666666; 0.8; 2.533333333333333; 0.0; 0.0 +1378440554; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 187343.46666666667; 0.0; 3.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1378440854; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 195732.8; 0.0; 1.0; 0.0; 0.0 +1378441154; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378441454; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1378441754; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378442054; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378442354; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 121632.8; 0.0; 1.0; 0.0; 0.0 +1378442654; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.2; 0.0; 0.0 +1378442954; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 113244.8; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1378443254; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 153789.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378443554; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378443854; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 150993.33333333334; 0.0; 1.0; 0.0; 0.0 +1378444154; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 187343.73333333334; 0.06666666666666667; 2.7333333333333334; 0.06666666666666667; 0.5333333333333333 +1378444454; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 159382.13333333333; 0.0; 1.0; 0.0; 0.0 +1378444754; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 156586.13333333333; 0.0; 1.0; 0.0; 0.0 +1378445054; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 127226.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378445354; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378445654; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378445954; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 107652.26666666666; 0.0; 1.2; 0.0; 0.0 +1378446254; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378446554; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378446855; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 142605.6; 0.0; 1.0; 0.0; 0.0 +1378447155; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 85282.13333333333; 0.0; 1.2; 0.0; 0.0 +1378447455; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378447755; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.06666666666666667; 3.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378448055; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 144003.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378448355; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 132817.86666666667; 0.0; 11.933333333333334; 0.0; 0.0 +1378448655; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1378448955; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378449255; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 120235.46666666666; 0.0; 2.3333333333333335; 0.06666666666666667; 0.13333333333333333 +1378449555; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 164974.93333333332; 0.0; 1.7333333333333334; 0.0; 0.0 +1378449855; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 150993.33333333334; 0.0; 6.666666666666667; 0.2; 0.13333333333333333 +1378450155; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 1.8666666666666667; 0.0; 0.0 +1378450455; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 109050.4; 0.0; 1.2; 0.0; 0.0 +1378450755; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.0; 0.0 +1378451055; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 137012.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378451355; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 135614.66666666666; 0.0; 2.6; 0.06666666666666667; 0.5333333333333333 +1378451655; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 142604.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378451955; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1378452255; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1378452555; 1; 2599.998989; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378452855; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 127225.06666666667; 0.0; 1.2; 0.0; 0.0 +1378453155; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378453455; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.2; 0.0; 0.0 +1378453755; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 135614.93333333332; 0.0; 1.1333333333333333; 0.0; 0.0 +1378454055; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 138411.2; 0.0; 1.3333333333333333; 0.0; 0.0 +1378454355; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378454655; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378454955; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 2.066666666666667; 0.06666666666666667; 0.4666666666666667 +1378455255; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378455555; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378455855; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378456155; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 131420.53333333333; 0.0; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1378456456; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1378456756; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378457056; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 132818.66666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378457356; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1378457656; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 138410.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378457956; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378458256; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 138411.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378458556; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 155186.93333333332; 0.06666666666666667; 2.4; 0.06666666666666667; 0.5333333333333333 +1378458856; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 157983.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378459156; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 127225.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378459456; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 135614.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378459756; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378460056; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1378460356; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378460656; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378460956; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378461256; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378461556; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378461856; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378462156; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 132818.4; 0.06666666666666667; 2.2; 0.06666666666666667; 0.5333333333333333 +1378462456; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 152391.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378462756; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378463056; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 99263.46666666666; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1378463356; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1378463657; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378463957; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 1.2666666666666666; 0.13333333333333333; 0.0 +1378464257; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1378464557; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378464857; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378465157; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 95069.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378465457; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 127226.13333333333; 0.0; 0.8; 0.13333333333333333; 0.0 +1378465757; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 142605.33333333334; 0.0; 2.1333333333333333; 0.0; 0.4666666666666667 +1378466057; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 176159.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378466357; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 135614.93333333332; 0.0; 1.0666666666666667; 0.0; 0.0 +1378466657; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378466957; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378467257; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378467557; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 125827.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378467857; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378468157; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 109050.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1378468457; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 116041.06666666667; 0.0; 7.0; 0.2; 0.13333333333333333 +1378468757; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1378469057; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 110448.53333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378469657; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 180352.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378470257; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378470557; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.2; 0.0 +1378470857; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 102059.73333333334; 0.0; 1.2; 0.06666666666666667; 0.0 +1378471157; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 92272.8; 0.0; 1.2; 0.06666666666666667; 0.0 +1378472057; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378472657; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.2666666666666666; 0.13333333333333333; 0.0 +1378472957; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 137012.0; 0.06666666666666667; 2.6666666666666665; 0.13333333333333333; 0.4666666666666667 +1378473257; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 130021.06666666667; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378473557; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 79689.6; 0.0; 1.2666666666666666; 0.2; 0.0 +1378473857; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378474157; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 132818.66666666666; 0.0; 0.8666666666666667; 0.2; 0.0 +1378474457; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.26666666666666666; 0.0 +1378474757; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 1.2; 0.13333333333333333; 0.0 +1378475057; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1378475358; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 99263.46666666666; 0.0; 7.266666666666667; 0.26666666666666666; 0.13333333333333333 +1378475658; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.2; 0.0 +1378475958; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 88078.4; 0.0; 1.0; 0.13333333333333333; 0.0 +1378476258; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 121633.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378476558; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 160779.46666666667; 0.06666666666666667; 2.533333333333333; 0.2; 0.5333333333333333 +1378476858; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 162178.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1378477158; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1378477458; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1378477758; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1378478058; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 131419.73333333334; 0.06666666666666667; 1.2; 0.06666666666666667; 0.13333333333333333 +1378478358; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 92272.8; 0.0; 1.2; 0.0; 0.0 +1378478658; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.2; 0.0 +1378478958; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 106253.33333333333; 0.0; 1.2; 0.06666666666666667; 0.0 +1378479258; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378479558; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 1.2; 0.0 +1378479858; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378480158; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 128623.2; 0.0; 2.2; 0.26666666666666666; 0.5333333333333333 +1378480458; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 118836.8; 0.0; 1.1333333333333333; 0.13333333333333333; 0.0 +1378480758; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 74097.06666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378481058; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378481358; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378481658; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378481958; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378482258; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 2.466666666666667; 0.26666666666666666; 0.13333333333333333 +1378482558; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 142604.8; 0.0; 5.933333333333334; 0.0; 0.0 +1378482858; 1; 2599.998989; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1378483158; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.0; 0.0 +1378483459; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1378483759; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 113244.8; 0.06666666666666667; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378484059; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378484359; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378484659; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378484959; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378485259; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378485559; 1; 2599.998989; 64.13330839533334; 2.466666666666667; 2097152.0; 350922.4; 161.06666666666666; 22.0; 2.1333333333333333; 0.4 +1378485859; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 706038.4; 0.0; 2.8; 0.0; 0.0 +1378486159; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 290803.2; 31.8; 3.7333333333333334; 0.0; 0.0 +1378486459; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 198527.73333333334; 0.26666666666666666; 2.2666666666666666; 0.0; 0.0 +1378486759; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 124429.86666666667; 0.0; 1.6; 0.13333333333333333; 0.0 +1378487059; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 76893.33333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378487359; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 128623.46666666666; 0.0; 2.2666666666666666; 0.06666666666666667; 0.4666666666666667 +1378487659; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 156586.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378487959; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 135613.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378488259; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 171964.8; 0.0; 6.866666666666666; 0.5333333333333333; 0.13333333333333333 +1378488559; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378488859; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378489159; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378489459; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1378489759; 1; 2599.998989; 0.0; 0.0; 2097152.0; 163576.53333333333; 0.0; 0.9333333333333333; 0.2; 0.0 +1378490059; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 152390.66666666666; 0.0; 1.0; 0.2; 0.0 +1378490359; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.13333333333333333; 0.0 +1378490659; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378490959; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 118837.06666666667; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1378491259; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 137012.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378491559; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1378491859; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 11.8; 0.0; 0.0 +1378492159; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 124429.06666666667; 0.0; 0.8; 0.0; 0.0 +1378492459; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 123031.73333333334; 0.0; 1.6666666666666667; 0.0; 0.0 +1378492759; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 1.3333333333333333; 0.0; 0.0 +1378493059; 1; 2599.998989; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 1.0; 0.0; 0.0 +1378493360; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378493660; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 128623.46666666666; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378493960; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125827.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378494260; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 104856.0; 0.0; 7.4; 0.26666666666666666; 0.13333333333333333 +1378494560; 1; 2599.998989; 24.266657230666667; 0.9333333333333332; 2097152.0; 183149.6; 0.06666666666666667; 2.4; 0.0; 0.5333333333333333 +1378494860; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 164974.4; 0.0; 1.7333333333333334; 0.0; 0.0 +1378495160; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378495460; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1378495760; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378496060; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378496360; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378496660; 1; 2599.998989; 41.599983824; 1.6; 2097152.0; 450186.93333333335; 161.8; 14.733333333333333; 0.0; 0.2 +1378496960; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 205519.46666666667; 0.0; 1.6; 0.0; 0.0 +1378497260; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 194333.33333333334; 31.8; 3.6; 0.0; 0.0 +1378497560; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378497860; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1378498160; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 127225.06666666667; 0.0; 2.533333333333333; 0.0; 0.5333333333333333 +1378498460; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 156585.6; 0.0; 1.0; 0.0; 0.0 +1378498760; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 138411.2; 0.0; 1.0; 0.0; 0.0 +1378499060; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378499360; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378499660; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 162177.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378499960; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 124429.86666666667; 12.733333333333333; 12.866666666666667; 0.4; 0.13333333333333333 +1378500260; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121632.8; 0.0; 1.3333333333333333; 0.0; 0.0 +1378500560; 1; 2599.998989; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378500860; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378501160; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1378501460; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378501760; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 156585.86666666667; 0.0; 2.3333333333333335; 0.06666666666666667; 0.5333333333333333 +1378502060; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 208314.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378502360; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 139809.33333333334; 0.0; 1.0; 0.0; 0.0 +1378502660; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378502960; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378503260; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378503560; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378503860; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378504160; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 106253.86666666667; 0.0; 0.8; 0.0; 0.0 +1378504460; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 124429.33333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378504760; 1; 2599.998989; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378505060; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 117438.4; 0.0; 1.0; 0.0; 0.0 +1378505360; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 170566.4; 0.06666666666666667; 2.6; 0.06666666666666667; 0.4666666666666667 +1378505660; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 183149.33333333334; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1378505960; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378506260; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 128624.0; 0.06666666666666667; 7.0; 0.3333333333333333; 0.13333333333333333 +1378506560; 1; 2599.998989; 0.0; 0.0; 2097152.0; 127225.6; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1378506860; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 134216.0; 0.06666666666666667; 1.5333333333333334; 0.4666666666666667; 0.06666666666666667 +1378507160; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378507460; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378507761; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378508061; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.2; 0.0; 0.0 +1378508361; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378508661; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378508961; 1; 2599.998989; 24.266657230666667; 0.9333333333333332; 2097152.0; 146799.2; 0.06666666666666667; 2.2; 0.0; 0.4666666666666667 +1378509261; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 134216.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378509561; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 148198.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378509861; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378510161; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1378510461; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378510761; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 75495.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378511061; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 96467.2; 0.0; 1.2; 0.0; 0.0 +1378511361; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378511661; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378511961; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378512261; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 138409.6; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1378512561; 1; 2599.998989; 24.266657230666667; 0.9333333333333332; 2097152.0; 138410.4; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1378512861; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.0; 0.0 +1378513161; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378513461; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 93670.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378513761; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 139809.33333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378514061; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 124429.06666666667; 0.5333333333333333; 1.3333333333333333; 0.13333333333333333; 0.0 +1378514361; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 144003.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378514661; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.4666666666666667; 0.0 +1378514961; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 124429.86666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1378515261; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.0; 0.0 +1378515561; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 55921.333333333336; 0.0; 0.9333333333333333; 0.0; 0.0 +1378515861; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378516161; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 146798.93333333332; 0.0; 2.6; 0.0; 0.5333333333333333 +1378516461; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 167770.66666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378516761; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 135613.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378517061; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 71300.8; 0.0; 1.0; 0.0; 0.0 +1378517361; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 72698.93333333333; 0.0; 1.0; 0.0; 0.0 +1378517661; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378517961; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 95069.06666666667; 0.0; 1.2; 0.0; 0.0 +1378518261; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 78291.46666666666; 0.2; 6.4; 0.2; 0.13333333333333333 +1378518561; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 163577.06666666668; 0.0; 1.4666666666666666; 0.0; 0.0 +1378518861; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378519161; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 118837.33333333333; 0.0; 1.2; 0.06666666666666667; 0.0 +1378519461; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378519761; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 145401.06666666668; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1378520061; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 159381.06666666668; 0.0; 0.8; 0.0; 0.0 +1378520361; 1; 2599.998989; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 1.2; 0.0; 0.0 +1378520662; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378520962; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 148197.33333333334; 0.0; 0.9333333333333333; 10.266666666666667; 0.0 +1378521262; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378521562; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.2; 0.0; 0.0 +1378521862; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 83884.0; 0.0; 1.2666666666666666; 0.0; 0.0 +1378522162; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378522462; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 83884.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378522762; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378523062; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 103457.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378523362; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 124428.8; 0.0; 2.533333333333333; 0.0; 0.4666666666666667 +1378523662; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 155187.2; 0.0; 1.0; 0.0; 0.0 +1378523962; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378524262; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378524562; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 8.2; 0.0 +1378524862; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378525162; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 120235.46666666666; 0.0; 6.733333333333333; 0.26666666666666666; 0.13333333333333333 +1378525462; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 65708.26666666666; 0.0; 1.4; 0.0; 0.0 +1378525762; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 139809.33333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1378526062; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 107652.26666666666; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378526362; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378526662; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 74097.06666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1378527862; 1; 2599.998989; 16.714279215; 0.6428571428571429; 2097152.0; 107852.0; 0.0; 1.0714285714285714; 0.07692307692307693; 0.0 +1378528762; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.4; 0.0 +1378529062; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 96467.2; 0.0; 1.0; 5.066666666666666; 0.0 +1378529362; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1378529662; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1378529963; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117438.4; 0.0; 0.6666666666666666; 0.0; 0.0 +1378530263; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1378530563; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 135614.93333333332; 0.06666666666666667; 8.333333333333334; 0.26666666666666666; 0.6 +1378530863; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 159381.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378531163; 1; 2599.998989; 0.0; 0.0; 2097152.0; 138410.4; 0.0; 0.8; 0.0; 0.0 +1378531463; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378531763; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1378532063; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1378532363; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378532663; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8; 0.06666666666666667; 0.0 +1378532963; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378533263; 1; 2599.998989; 60.66664307666668; 2.3333333333333335; 2097152.0; 406845.3333333333; 161.06666666666666; 21.533333333333335; 0.06666666666666667; 0.4 +1378533563; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 562034.4; 0.0; 2.533333333333333; 0.06666666666666667; 0.0 +1378533863; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 293599.2; 31.8; 4.333333333333333; 0.06666666666666667; 0.0 +1378534163; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 251656.0; 0.8; 3.933333333333333; 0.06666666666666667; 0.4666666666666667 +1378534463; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 167770.4; 0.0; 1.5333333333333334; 0.0; 0.0 +1378534763; 1; 2599.998989; 0.0; 0.0; 2097152.0; 144002.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1378535063; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1378535363; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.8; 0.0; 0.0 +1378535663; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 13.4; 0.13333333333333333; 0.13333333333333333 +1378535963; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 134215.2; 0.0; 1.4666666666666666; 0.13333333333333333; 0.0 +1378536263; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121632.8; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1378536563; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378536863; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.5333333333333334; 0.0; 0.0 +1378537163; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378537463; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 121633.6; 0.0; 7.0; 0.2; 0.13333333333333333 +1378537763; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 139808.53333333333; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1378538063; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 125827.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378538363; 1; 2599.998989; 0.0; 0.0; 2097152.0; 159383.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378538663; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378538963; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1378539263; 1; 2599.998989; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378539563; 1; 2599.998989; 0.0; 0.0; 2097152.0; 142605.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378539863; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 2.066666666666667; 0.06666666666666667; 0.0 +1378540163; 1; 2599.998989; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378540463; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378540763; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378541063; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 118837.33333333333; 0.06666666666666667; 1.8666666666666667; 0.0; 0.0 +1378541363; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 125827.2; 0.13333333333333333; 2.533333333333333; 0.0; 0.4666666666666667 +1378541663; 1; 2599.998989; 0.0; 0.0; 2097152.0; 148197.33333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378541963; 1; 2599.998989; 0.0; 0.0; 2097152.0; 138410.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378542263; 1; 2599.998989; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378542563; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378542863; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378543163; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.0; 1.8666666666666667; 0.0 +1378543463; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 134216.8; 0.06666666666666667; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1378543763; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378544063; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378544364; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378544664; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378544964; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 146799.2; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1378545264; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 149596.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378545564; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378545864; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1378546164; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378546464; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378546764; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 146798.93333333332; 0.0; 1.4; 0.0; 0.0 +1378547064; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378547364; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378547664; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378547964; 1; 2599.998989; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0; 0.0; 0.0 +1378548264; 1; 2599.998989; 0.0; 0.0; 2097152.0; 137012.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378548564; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 125828.0; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378548864; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 1.0; 0.0; 0.0 +1378549164; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378549464; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.2; 0.06666666666666667; 0.0 +1378549764; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 138410.4; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1378550064; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131419.73333333334; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378550364; 1; 2599.998989; 0.0; 0.0; 2097152.0; 142605.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378550664; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378550964; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378551264; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378551564; 1; 2599.998989; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378551864; 1; 2599.998989; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378552164; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 138409.86666666667; 0.0; 2.6; 0.06666666666666667; 0.4666666666666667 +1378552464; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 213907.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378552764; 1; 2599.998989; 0.0; 0.0; 2097152.0; 155187.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378553064; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378553364; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.26666666666666666; 0.0 +1378553664; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117438.4; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378553964; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378554264; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378554564; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.06666666666666667; 0.0 +1378554865; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378555165; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378555465; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378555765; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 123031.2; 0.06666666666666667; 8.733333333333333; 0.26666666666666666; 0.6 +1378556065; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 124429.6; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1378556365; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.2; 0.0; 0.0 +1378556665; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378556965; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 1.0; 4.2; 0.0 +1378557265; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378557565; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.0; 0.0 +1378557865; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378558165; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.06666666666666667; 0.0 +1378558465; 1; 2599.998989; 0.0; 0.0; 2097152.0; 160779.46666666667; 0.0; 0.8; 0.0; 0.0 +1378558765; 1; 2599.998989; 0.0; 0.0; 2097152.0; 145401.06666666668; 0.0; 1.0; 0.0; 0.0 +1378559065; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131419.73333333334; 0.0; 1.0; 0.0; 0.0 +1378559365; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 116040.53333333334; 0.0; 2.4; 0.0; 0.4666666666666667 +1378559665; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 148197.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1378559965; 1; 2599.998989; 0.0; 0.0; 2097152.0; 135614.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378560265; 1; 2599.998989; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.8; 0.0; 0.0 +1378560565; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1378560865; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378561165; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 146800.0; 12.733333333333333; 13.133333333333333; 0.3333333333333333; 0.2 +1378561465; 1; 2599.998989; 0.0; 0.0; 2097152.0; 156585.33333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1378561765; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378562065; 1; 2599.998989; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378562366; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378562666; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 118836.53333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378562966; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 121633.6; 0.0; 2.466666666666667; 0.13333333333333333; 0.4666666666666667 +1378563266; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378563566; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378563866; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378564166; 1; 2599.998989; 0.0; 0.0; 2097152.0; 141207.46666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378564466; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 132817.86666666667; 0.0; 1.9333333333333333; 0.06666666666666667; 0.13333333333333333 +1378564766; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378565066; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378565366; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378565666; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378565966; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 104855.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378566266; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378566566; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 145401.06666666668; 0.06666666666666667; 8.266666666666667; 0.2; 0.6 +1378566866; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 173363.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378567166; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378567466; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.2; 0.0; 0.0 +1378567766; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378568066; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1378568366; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378568666; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378568966; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.2; 0.0; 0.0 +1378569266; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378569566; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378569866; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 118837.33333333333; 0.0; 0.8; 0.0; 0.0 +1378570166; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 152391.2; 0.06666666666666667; 2.6666666666666665; 0.0; 0.4666666666666667 +1378570466; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 148197.6; 0.06666666666666667; 1.2; 0.0; 0.0 +1378570766; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378571066; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.0; 0.0 +1378571366; 1; 2599.998989; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378571666; 1; 2599.998989; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 1.2; 0.13333333333333333; 0.0 +1378571966; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378572266; 1; 2599.998989; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378572566; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 93670.93333333333; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1378572866; 1; 2599.998989; 0.0; 0.0; 2097152.0; 145401.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1378573166; 1; 2599.998989; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.2; 0.0; 0.0 +1378573466; 1; 2599.998989; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1378573766; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 141206.13333333333; 0.06666666666666667; 2.2666666666666666; 0.0; 0.4666666666666667 +1378574066; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 141206.4; 0.0; 1.0; 0.0; 0.0 +1378574367; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 103457.86666666667; 0.0; 1.4; 0.0; 0.0 +1378574667; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378574967; 1; 2599.998989; 0.0; 0.0; 2097152.0; 139809.33333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1378575267; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 134216.26666666666; 0.0; 1.0; 0.0; 0.0 +1378575567; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378575867; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1378576167; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378576467; 1; 2599.998989; 0.0; 0.0; 2097152.0; 71300.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378576767; 1; 2599.998989; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378577067; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 82485.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378577367; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 139808.53333333333; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378577667; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 139809.33333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378577967; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 124429.86666666667; 0.2; 7.0; 0.2; 0.13333333333333333 +1378578267; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378578567; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1378578867; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378579167; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 107652.26666666666; 0.0; 11.933333333333334; 0.0; 0.0 +1378579467; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378579767; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378580067; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378580367; 1; 2599.998989; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.0; 0.0 +1378580667; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 130022.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378580967; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 128624.0; 0.0; 2.2666666666666666; 0.06666666666666667; 0.5333333333333333 +1378581267; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 170566.66666666666; 0.0; 1.8666666666666667; 0.0; 0.0 +1378581567; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378581867; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378582167; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378582467; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1378582767; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 134216.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378583067; 1; 2599.998989; 38.133318505333335; 1.4666666666666666; 2097152.0; 436206.4; 161.73333333333332; 14.8; 0.0; 0.2 +1378583368; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 304784.5333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378583668; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 152390.93333333332; 31.8; 8.6; 0.2; 0.13333333333333333 +1378583968; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 188741.33333333334; 0.0; 2.3333333333333335; 0.0; 0.0 +1378584268; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378584568; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 128624.0; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1378584868; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 150993.06666666668; 0.0; 0.8; 0.0; 0.0 +1378585168; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1378585468; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378585768; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378586068; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1378586368; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 67106.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378586668; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378586968; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0; 0.0; 0.0 +1378587268; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378587568; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378587868; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 106254.13333333333; 0.0; 1.0; 0.0; 0.0 +1378588168; 1; 2599.998989; 25.999989890000002; 1.0; 2097152.0; 142604.53333333333; 0.0; 2.3333333333333335; 0.0; 0.5333333333333333 +1378588468; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 145401.33333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378588768; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 128623.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378589068; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378589368; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1378589668; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 139809.33333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378589968; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 137012.8; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1378590268; 1; 2599.998989; 67.599973714; 2.6; 2097152.0; 595589.6; 161.06666666666666; 22.133333333333333; 0.06666666666666667; 0.4 +1378590568; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 433409.6; 0.0; 2.4; 0.0; 0.0 +1378590868; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 239072.8; 31.8; 3.933333333333333; 0.0; 0.0 +1378591168; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 192936.26666666666; 0.8666666666666667; 2.533333333333333; 0.0; 0.0 +1378591468; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 132818.66666666666; 0.0; 1.5333333333333334; 0.0; 0.0 +1378591768; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 146799.2; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378592068; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 146800.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1378592368; 1; 2599.998989; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 1.2; 0.0; 0.0 +1378592668; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378592968; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378593269; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 134216.0; 0.0; 1.5333333333333334; 0.06666666666666667; 0.13333333333333333 +1378593569; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1378593869; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0; 0.0; 0.0 +1378594169; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378594469; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378594769; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.8; 0.0; 0.0 +1378595069; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 137012.8; 0.0; 1.2; 0.0; 0.0 +1378595369; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 171964.8; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1378595669; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 195731.46666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378595969; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 141207.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378596269; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378596569; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 90874.66666666667; 0.0; 6.0; 0.2; 0.13333333333333333 +1378596869; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 127226.13333333333; 0.0; 2.2; 0.0; 0.0 +1378597169; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1378597469; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 1.3333333333333333; 0.0; 0.0 +1378597769; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 130022.4; 0.0; 1.0; 0.0; 0.0 +1378598069; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.2; 0.0; 0.0 +1378598369; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378598669; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1378598969; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 162176.8; 0.0; 2.1333333333333333; 0.0; 0.4666666666666667 +1378599269; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 153790.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378599569; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1378599869; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1378600169; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378600469; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 130022.4; 0.5333333333333333; 1.3333333333333333; 0.06666666666666667; 0.0 +1378600769; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 131420.53333333333; 0.0; 1.0; 0.0; 0.0 +1378601069; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378601369; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 107652.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1378601669; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378601970; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 86680.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378602269; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378602569; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 155188.0; 0.2; 2.7333333333333334; 0.06666666666666667; 0.4666666666666667 +1378602869; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 141207.46666666667; 0.0; 0.8; 0.0; 0.0 +1378603169; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 141206.93333333332; 0.0; 6.933333333333334; 0.26666666666666666; 0.13333333333333333 +1378603469; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378603769; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1378604069; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 137012.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1378604369; 1; 2599.998989; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378604669; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378604969; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378605269; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378605569; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1378605869; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 0.8; 0.0; 0.0 +1378606169; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 141207.46666666667; 0.06666666666666667; 2.3333333333333335; 0.0; 0.4666666666666667 +1378606469; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 134216.26666666666; 0.0; 0.8; 0.0; 0.0 +1378606769; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.8; 0.0; 0.0 +1378607069; 1; 2599.998989; 0.0; 0.0; 2097152.0; 153790.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1378607369; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378607669; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378607970; 1; 2599.998989; 0.0; 0.0; 2097152.0; 65708.26666666666; 0.0; 0.8; 0.0; 0.0 +1378608270; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1378608570; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8; 0.06666666666666667; 0.0 +1378608870; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378609170; 1; 2599.998989; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378609470; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 121633.6; 0.8666666666666667; 1.3333333333333333; 0.06666666666666667; 0.0 +1378609770; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 138411.2; 0.0; 2.2; 0.0; 0.4666666666666667 +1378610070; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 155187.2; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1378610370; 1; 2599.998989; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378610670; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8; 0.0; 0.0 +1378610970; 1; 2599.998989; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378611270; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378611570; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1378611870; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.6666666666666667; 0.0; 0.0 +1378612170; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1378612470; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.06666666666666667; 0.0 +1378612770; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378613070; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378613370; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 145401.86666666667; 0.06666666666666667; 2.533333333333333; 0.0; 0.4666666666666667 +1378613670; 1; 2599.998989; 0.0; 0.0; 2097152.0; 134216.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378613970; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378614270; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378614570; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118836.53333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378614870; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378615170; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378615470; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378615770; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378616070; 1; 2599.998989; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 1.2; 0.0; 0.0 +1378616370; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 146799.2; 0.06666666666666667; 7.266666666666667; 0.2; 0.13333333333333333 +1378616670; 1; 2599.998989; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378616970; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 120235.46666666666; 0.0; 2.2; 0.0; 0.4666666666666667 +1378617270; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 167770.4; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378617570; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378617871; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 92272.0; 0.0; 0.8666666666666667; 7.6; 0.0 +1378618171; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1378618471; 1; 2599.998989; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378618771; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.2; 0.0; 0.0 +1378619071; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378619371; 1; 2599.998989; 0.0; 0.0; 2097152.0; 149596.26666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378619671; 1; 2599.998989; 0.0; 0.0; 2097152.0; 146798.4; 0.0; 1.0; 0.0; 0.0 +1378619971; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378620271; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378620571; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 134216.0; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378620871; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 213908.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378621171; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1378621471; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378621771; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117438.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378622071; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 130021.6; 0.0; 2.3333333333333335; 0.06666666666666667; 0.06666666666666667 +1378622371; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 1.4666666666666666; 0.0; 0.0 +1378622671; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 11.866666666666667; 0.06666666666666667; 0.0 +1378622971; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 117438.4; 12.733333333333333; 13.666666666666666; 0.26666666666666666; 0.13333333333333333 +1378623271; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378623571; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378623871; 1; 2599.998989; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 1.0; 0.0; 0.0 +1378624171; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 96467.2; 0.0; 2.4; 0.06666666666666667; 0.4666666666666667 +1378624472; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 146800.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378624772; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 1.0; 0.2; 0.0 +1378625072; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1378625372; 1; 2599.998989; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378625672; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378625972; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.7333333333333334; 0.0; 0.0 +1378626272; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.6; 0.0; 0.0 +1378626572; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378626872; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378627172; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378627472; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116040.26666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378627772; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 153789.6; 0.2; 2.4; 0.06666666666666667; 0.4666666666666667 +1378628072; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 184548.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378628372; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 138411.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378628672; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378628972; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1378629272; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 89476.53333333334; 0.0; 7.0; 0.26666666666666666; 0.13333333333333333 +1378629572; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125827.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378629872; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117438.4; 0.0; 1.2; 0.06666666666666667; 0.0 +1378630172; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378630472; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378630772; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1378631073; 1; 2599.998989; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378631373; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 134216.0; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1378631673; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 123031.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378631973; 1; 2599.998989; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378632273; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378632573; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 96467.2; 0.0; 1.2666666666666666; 0.0; 0.0 +1378632873; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1378633173; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0; 0.06666666666666667; 0.0 +1378633473; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 76893.33333333333; 0.0; 0.8; 0.0; 0.0 +1378633773; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1378634073; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378634373; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378634673; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.0; 0.0 +1378634973; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 170566.4; 0.0; 8.4; 0.2; 0.6666666666666666 +1378635273; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 170566.4; 0.06666666666666667; 1.4666666666666666; 0.06666666666666667; 0.0 +1378635573; 1; 2599.998989; 0.0; 0.0; 2097152.0; 171964.53333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1378635873; 1; 2599.998989; 0.0; 0.0; 2097152.0; 137012.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378636173; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378636473; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378636773; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 130022.4; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378637073; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378637373; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378637673; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1378637973; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378638273; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378638573; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 127226.13333333333; 0.2; 2.533333333333333; 0.0; 0.4666666666666667 +1378638873; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378639173; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378639473; 1; 2599.998989; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1378639773; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378640073; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 139808.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378640373; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378640673; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.4; 0.0; 0.0 +1378640973; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 120234.66666666667; 0.06666666666666667; 7.133333333333334; 0.3333333333333333; 0.13333333333333333 +1378641273; 1; 2599.998989; 0.0; 0.0; 2097152.0; 166373.06666666668; 0.0; 1.0; 0.0; 0.0 +1378641573; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123030.93333333333; 0.0; 1.0; 0.0; 0.0 +1378641873; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378642173; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 167770.66666666666; 0.0; 2.7333333333333334; 0.0; 0.4666666666666667 +1378642473; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 183149.6; 0.0; 0.8; 0.0; 0.0 +1378642774; 1; 2599.998989; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378643074; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378643374; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 173362.93333333332; 161.0; 21.866666666666667; 0.06666666666666667; 0.4 +1378643674; 1; 2599.998989; 55.46664509866667; 2.1333333333333333; 2097152.0; 708835.7333333333; 0.0; 2.8666666666666667; 0.06666666666666667; 0.0 +1378643974; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 318765.3333333333; 31.8; 3.6666666666666665; 0.0; 0.0 +1378644274; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 183148.53333333333; 0.8; 2.2; 0.0; 0.0 +1378644574; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 150992.53333333333; 0.0; 1.6; 0.0; 0.0 +1378644874; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1378645174; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1378645474; 1; 2599.998989; 0.0; 0.0; 2097152.0; 152390.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378645774; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 153790.13333333333; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1378646074; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 162177.6; 0.0; 1.0; 0.0; 0.0 +1378646374; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.2; 0.0; 0.0 +1378646674; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 117439.2; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1378646974; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378647274; 1; 2599.998989; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378647574; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 148197.33333333334; 1.0; 1.7333333333333334; 0.0; 0.0 +1378647874; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.2; 0.0; 0.0 +1378648174; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378648474; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378648774; 1; 2599.998989; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378649074; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 74097.06666666667; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378649374; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 137012.26666666666; 0.06666666666666667; 2.533333333333333; 0.0; 0.4666666666666667 +1378649674; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 176159.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378649974; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378650274; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378650574; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 1.2; 0.0; 0.0 +1378650874; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 155188.8; 0.06666666666666667; 1.3333333333333333; 0.06666666666666667; 0.13333333333333333 +1378651174; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378651474; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116040.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378651775; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 141207.46666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378652075; 1; 2599.998989; 0.0; 0.0; 2097152.0; 130022.4; 0.0; 0.8; 0.0; 0.0 +1378652375; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378652675; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 104856.0; 0.0; 6.8; 0.26666666666666666; 0.13333333333333333 +1378652975; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 149595.46666666667; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1378653275; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 145401.06666666668; 0.0; 1.1333333333333333; 0.0; 0.0 +1378653575; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378653875; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378654175; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378654475; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8; 0.0; 0.0 +1378654775; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378655075; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378655375; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378655675; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378655975; 1; 2599.998989; 0.0; 0.0; 2097152.0; 146798.13333333333; 0.0; 1.0; 0.0; 0.0 +1378656275; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 0.8; 0.0; 0.0 +1378656575; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 117439.2; 0.0; 2.2; 0.0; 0.5333333333333333 +1378656875; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 127225.33333333333; 0.0; 0.8; 0.0; 0.0 +1378657175; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378657475; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 114642.93333333333; 0.0; 1.2; 0.0; 0.0 +1378657775; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378658076; 1; 2599.998989; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1378658376; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378658676; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378658976; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123030.93333333333; 0.0; 0.8; 0.0; 0.0 +1378659276; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378659576; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 89476.53333333334; 0.0; 6.933333333333334; 0.2; 0.13333333333333333 +1378659876; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378660176; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 148196.8; 0.0; 2.8; 0.0; 0.4666666666666667 +1378660476; 1; 2599.998989; 0.0; 0.0; 2097152.0; 152391.46666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378660776; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378661076; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1378661376; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1378661676; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378661976; 1; 2599.998989; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378662276; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378662576; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378662876; 1; 2599.998989; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378663176; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8; 0.0; 0.0 +1378663476; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378663776; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 148197.6; 0.06666666666666667; 2.533333333333333; 0.0; 0.4666666666666667 +1378664076; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 138410.13333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378664376; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 95069.06666666667; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378664676; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378664976; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378665276; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 150994.4; 0.0; 6.733333333333333; 0.26666666666666666; 0.2 +1378665576; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 145401.86666666667; 0.0; 0.8; 0.0; 0.0 +1378665876; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 132817.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378666176; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1378666476; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 11.8; 0.0; 0.0 +1378666776; 1; 2599.998989; 0.0; 0.0; 2097152.0; 135614.66666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378667076; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 120234.93333333333; 0.0; 1.2; 0.0; 0.0 +1378667377; 1; 2599.998989; 22.53332457133334; 0.8666666666666667; 2097152.0; 117439.2; 0.0; 2.3333333333333335; 0.0; 0.5333333333333333 +1378667677; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378667976; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378668276; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378668576; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 92272.8; 0.0; 1.2; 0.0; 0.0 +1378668876; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378669176; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378669476; 1; 2599.998989; 39.86665116466667; 1.5333333333333334; 2097152.0; 321561.6; 161.73333333333332; 14.733333333333333; 0.0; 0.2 +1378669776; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 339736.26666666666; 0.0; 1.8666666666666667; 0.0; 0.0 +1378670076; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 162178.66666666666; 31.8; 3.7333333333333334; 0.0; 0.0 +1378670376; 1; 2599.998989; 0.0; 0.0; 2097152.0; 134216.8; 0.0; 1.8; 0.0; 0.0 +1378670676; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 130021.6; 0.0; 7.0; 0.2; 0.13333333333333333 +1378670976; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 142604.53333333333; 0.06666666666666667; 2.7333333333333334; 0.0; 0.5333333333333333 +1378671276; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125827.73333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1378671576; 1; 2599.998989; 0.0; 0.0; 2097152.0; 67106.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378671876; 1; 2599.998989; 0.0; 0.0; 2097152.0; 72698.93333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378672176; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1378672477; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 121633.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378672777; 1; 2599.998989; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.2; 0.0; 0.0 +1378673077; 1; 2599.998989; 0.0; 0.0; 2097152.0; 74097.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378673377; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378673677; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378673977; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.2666666666666666; 0.0; 0.0 +1378674277; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378674577; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 128624.26666666666; 0.13333333333333333; 2.533333333333333; 0.0; 0.4666666666666667 +1378674877; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 0.8; 0.0; 0.0 +1378675177; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378675477; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378675777; 1; 2599.998989; 0.0; 0.0; 2097152.0; 67106.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378676077; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1378676377; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 85282.13333333333; 0.06666666666666667; 1.5333333333333334; 0.2; 0.13333333333333333 +1378676677; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 150993.33333333334; 0.0; 6.666666666666667; 0.0; 0.0 +1378676977; 1; 2599.998989; 0.0; 0.0; 2097152.0; 127225.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378677277; 1; 2599.998989; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 1.0; 0.0; 0.0 +1378677577; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378677877; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 83884.0; 0.26666666666666666; 1.1333333333333333; 0.0; 0.0 +1378678177; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 138410.13333333333; 0.0; 2.533333333333333; 0.0; 0.5333333333333333 +1378678477; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 124428.53333333334; 0.0; 1.0; 0.0; 0.0 +1378678777; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378679077; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1378679377; 1; 2599.998989; 0.0; 0.0; 2097152.0; 145401.86666666667; 0.0; 0.8; 0.0; 0.0 +1378679677; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 130022.4; 0.0; 1.8; 0.06666666666666667; 0.13333333333333333 +1378679977; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 166373.06666666668; 0.0; 0.8; 0.0; 0.0 +1378680277; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378680577; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0; 0.0; 0.0 +1378680877; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1378681178; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378681478; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 118837.33333333333; 0.2; 1.0666666666666667; 0.0; 0.0 +1378681778; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 137013.06666666668; 0.0; 2.4; 0.0; 0.4666666666666667 +1378682078; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 130022.4; 0.0; 0.8; 0.0; 0.0 +1378682378; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 124429.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378682678; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 111846.13333333333; 12.733333333333333; 13.066666666666666; 0.3333333333333333; 0.13333333333333333 +1378682978; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 145400.53333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378683278; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378683578; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 99263.46666666666; 0.0; 1.0; 0.0; 0.0 +1378683878; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 88078.4; 0.0; 1.3333333333333333; 0.0; 0.0 +1378684178; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8; 0.0; 0.0 +1378684478; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 130022.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378684778; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 0.8; 0.0; 0.0 +1378685078; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378685378; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 184547.73333333334; 0.06666666666666667; 2.466666666666667; 0.0; 0.5333333333333333 +1378685678; 1; 2599.998989; 0.0; 0.0; 2097152.0; 213908.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378685978; 1; 2599.998989; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378686278; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378686578; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378686878; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 164974.4; 0.6; 1.2666666666666666; 0.0; 0.0 +1378687178; 1; 2599.998989; 0.0; 0.0; 2097152.0; 164973.33333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378687478; 1; 2599.998989; 0.0; 0.0; 2097152.0; 127225.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378687778; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378688078; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378688378; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378688678; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378688978; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 149596.0; 0.0; 2.2666666666666666; 0.0; 0.4666666666666667 +1378689278; 1; 2599.998989; 0.0; 0.0; 2097152.0; 162177.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378689578; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 113244.8; 0.0; 7.2; 0.2; 0.13333333333333333 +1378689878; 1; 2599.998989; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 1.0666666666666667; 0.0; 0.0 +1378690178; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378690478; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378690778; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.2666666666666666; 0.0; 0.0 +1378691079; 1; 2599.998989; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378691379; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 1.0; 0.0; 0.0 +1378691679; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378691979; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378692279; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378692579; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 131419.73333333334; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1378692879; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 155188.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378693179; 1; 2599.998989; 0.0; 0.0; 2097152.0; 148196.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378693479; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378693779; 1; 2599.998989; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378694079; 1; 2599.998989; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378694379; 1; 2599.998989; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378694679; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1378694979; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378695279; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 131420.53333333333; 0.0; 6.866666666666666; 0.2; 0.13333333333333333 +1378695579; 1; 2599.998989; 0.0; 0.0; 2097152.0; 135614.93333333332; 0.0; 0.8666666666666667; 0.0; 0.0 +1378695879; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378696179; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 117439.2; 0.0; 2.8; 0.0; 0.4666666666666667 +1378696479; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378696779; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378697079; 1; 2599.998989; 64.13330839533334; 2.466666666666667; 2097152.0; 426419.2; 161.2; 21.733333333333334; 0.06666666666666667; 0.4 +1378697379; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 539665.0666666667; 0.0; 2.8; 0.0; 0.0 +1378697679; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 246063.46666666667; 31.8; 3.6666666666666665; 0.0; 0.0 +1378697979; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 159382.4; 0.8; 2.6666666666666665; 0.0; 0.0 +1378698279; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 124429.86666666667; 0.0; 1.8666666666666667; 0.0; 0.0 +1378698579; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 155187.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378698879; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378699180; 1; 2599.998989; 0.0; 0.0; 2097152.0; 142605.6; 0.0; 1.0; 0.0; 0.0 +1378699480; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378699780; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 134216.53333333333; 6.8; 2.533333333333333; 0.0; 0.4666666666666667 +1378700080; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118836.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378700380; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378700679; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378700979; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378701279; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 142605.6; 0.0; 7.066666666666666; 0.26666666666666666; 0.2 +1378701579; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378701879; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378702179; 1; 2599.998989; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 1.0; 0.0; 0.0 +1378702479; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378702779; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378703079; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378703379; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 183149.06666666668; 0.06666666666666667; 2.4; 0.0; 0.4666666666666667 +1378703680; 1; 2599.998989; 0.0; 0.0; 2097152.0; 160780.53333333333; 0.0; 1.0; 0.0; 0.0 +1378703980; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378704280; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 111846.66666666667; 1.0; 2.0; 0.0; 0.0 +1378704580; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378704880; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378705180; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378705480; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378705780; 1; 2599.998989; 0.0; 0.0; 2097152.0; 139809.33333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378706080; 1; 2599.998989; 0.0; 0.0; 2097152.0; 144002.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1378706380; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378706680; 1; 2599.998989; 0.0; 0.0; 2097152.0; 150993.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378706980; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 134216.0; 0.0; 1.9333333333333333; 0.0; 0.4666666666666667 +1378707280; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 6.333333333333333; 0.26666666666666666; 0.13333333333333333 +1378707580; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 148196.53333333333; 0.0; 1.5333333333333334; 0.0; 0.0 +1378707880; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378708180; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378708480; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.06666666666666667; 2.8; 0.06666666666666667; 0.06666666666666667 +1378708780; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 142604.53333333333; 0.0; 1.8; 0.0; 0.0 +1378709080; 1; 2599.998989; 0.0; 0.0; 2097152.0; 167770.4; 0.0; 1.0; 0.0; 0.0 +1378709380; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 135614.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378709680; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128623.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378709980; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 81087.73333333334; 0.0; 11.933333333333334; 0.0; 0.0 +1378710280; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378710580; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 135613.33333333334; 0.26666666666666666; 2.3333333333333335; 0.0; 0.4666666666666667 +1378710880; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 156585.6; 0.0; 1.0; 0.0; 0.0 +1378711180; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378711481; 1; 2599.998989; 0.0; 0.0; 2097152.0; 82485.86666666667; 0.0; 1.0; 0.0; 0.0 +1378711781; 1; 2599.998989; 0.0; 0.0; 2097152.0; 135613.86666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1378712081; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.13333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378712381; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378712681; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.9333333333333333; 0.0; 0.0 +1378712981; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378713281; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378713581; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378713881; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.13333333333333333; 0.0 +1378714181; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 174760.8; 0.0; 8.6; 0.2; 0.6666666666666666 +1378714481; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 155187.46666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378714781; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131419.73333333334; 0.0; 1.6666666666666667; 0.06666666666666667; 0.0 +1378715081; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123030.93333333333; 0.0; 1.0; 0.0; 0.0 +1378715381; 1; 2599.998989; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 1.2; 0.0; 0.0 +1378715681; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378715981; 1; 2599.998989; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378716281; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378716581; 1; 2599.998989; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378716881; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1378717181; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378717481; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378717782; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 128624.0; 0.0; 2.4; 0.0; 0.4666666666666667 +1378718082; 1; 2599.998989; 0.0; 0.0; 2097152.0; 152391.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378718382; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378718682; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378718982; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378719282; 1; 2599.998989; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378719582; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.2; 0.0; 0.0 +1378719882; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378720182; 1; 2599.998989; 0.0; 0.0; 2097152.0; 141207.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378720482; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1378720782; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8; 0.0; 0.0 +1378721082; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378721382; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 145400.8; 0.0; 8.733333333333333; 0.2; 0.6 +1378721682; 1; 2599.998989; 0.0; 0.0; 2097152.0; 153788.53333333333; 0.0; 0.8; 0.0; 0.0 +1378721982; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378722282; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1378722582; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378722882; 1; 2599.998989; 0.0; 0.0; 2097152.0; 142604.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378723182; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378723482; 1; 2599.998989; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1378723782; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.3333333333333333; 0.0; 0.0 +1378724082; 1; 2599.998989; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378724382; 1; 2599.998989; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 1.0; 0.0; 0.0 +1378724682; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.7333333333333333; 0.0; 0.0 +1378724982; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 128624.26666666666; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378725282; 1; 2599.998989; 0.0; 0.0; 2097152.0; 145401.06666666668; 0.0; 0.8; 0.0; 0.0 +1378725582; 1; 2599.998989; 0.0; 0.0; 2097152.0; 150993.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1378725882; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.7333333333333333; 0.0; 0.0 +1378726182; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.8; 0.26666666666666666; 0.0 +1378726482; 1; 2599.998989; 0.0; 0.0; 2097152.0; 141207.46666666667; 0.0; 1.0; 0.0; 0.0 +1378726782; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378727082; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.4; 0.0; 0.0 +1378727382; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8; 0.0; 0.0 +1378727682; 1; 2599.998989; 0.0; 0.0; 2097152.0; 89476.26666666666; 0.0; 0.8; 0.13333333333333333; 0.0 +1378727983; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 208314.93333333332; 0.0; 7.066666666666666; 0.2; 0.13333333333333333 +1378728283; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 125828.0; 0.0; 0.6666666666666666; 0.0; 0.0 +1378728583; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 156585.06666666668; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1378728883; 1; 2599.998989; 0.0; 0.0; 2097152.0; 153790.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378729183; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378729483; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.0; 0.0 +1378729783; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.7333333333333333; 0.13333333333333333; 0.0 +1378730083; 1; 2599.998989; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.8; 0.0; 0.0 +1378730383; 1; 2599.998989; 0.0; 0.0; 2097152.0; 127225.06666666667; 0.0; 0.6666666666666666; 0.0; 0.0 +1378730683; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 128624.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378730983; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378731283; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1378731583; 1; 2599.998989; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 1.0; 0.0; 0.0 +1378731883; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378732183; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 162178.4; 0.06666666666666667; 2.466666666666667; 0.0; 0.4666666666666667 +1378732483; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 135613.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378732783; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 0.8; 0.06666666666666667; 0.0 +1378733083; 1; 2599.998989; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378733383; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 114642.93333333333; 0.0; 7.2; 0.26666666666666666; 0.2 +1378733683; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378733983; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378734283; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8; 0.06666666666666667; 0.0 +1378734583; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.7333333333333333; 0.0; 0.0 +1378734883; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378735183; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1378735483; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.6666666666666666; 0.3333333333333333; 0.0 +1378735783; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 180352.8; 0.13333333333333333; 2.6; 0.0; 0.4666666666666667 +1378736083; 1; 2599.998989; 0.0; 0.0; 2097152.0; 167770.4; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378736383; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.0; 0.0; 0.0 +1378736683; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378736983; 1; 2599.998989; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378737283; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 1.2666666666666666; 0.06666666666666667; 0.13333333333333333 +1378737583; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378737883; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378738183; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116040.26666666666; 0.0; 1.0; 0.0; 0.0 +1378738483; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.06666666666666667; 0.0 +1378738783; 1; 2599.998989; 0.0; 0.0; 2097152.0; 69902.66666666667; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378739083; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 6.266666666666667; 0.2; 0.13333333333333333 +1378739383; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 181750.93333333332; 0.0; 2.8666666666666667; 0.06666666666666667; 0.4666666666666667 +1378739683; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 157983.46666666667; 0.0; 1.0; 0.0; 0.0 +1378739983; 1; 2599.998989; 0.0; 0.0; 2097152.0; 167771.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378740283; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.6666666666666666; 0.0 +1378740583; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378740883; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378741183; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378741483; 1; 2599.998989; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 1.2666666666666666; 0.26666666666666666; 0.0 +1378741783; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.1333333333333333; 0.0; 0.0 +1378742084; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378742384; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378742684; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378742984; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 138410.4; 0.0; 2.466666666666667; 0.0; 0.4666666666666667 +1378743284; 1; 2599.998989; 0.0; 0.0; 2097152.0; 130021.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378743584; 1; 2599.998989; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378743884; 1; 2599.998989; 0.0; 0.0; 2097152.0; 78291.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378744184; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378744484; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.2; 0.0; 0.0 +1378744784; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378745084; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.26666666666666666; 0.0 +1378745384; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 114642.93333333333; 12.733333333333333; 12.133333333333333; 0.4; 0.2 +1378745684; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 150993.6; 0.0; 2.4; 0.0; 0.0 +1378745984; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.4666666666666666; 0.0; 0.0 +1378746284; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 96467.2; 1.4666666666666666; 1.2; 0.0; 0.0 +1378746584; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 125828.0; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1378746884; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378747184; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 130022.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378747484; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.0; 0.0; 0.0 +1378747784; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1378748084; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378748384; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378748684; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378748984; 1; 2599.998989; 65.86664105466667; 2.533333333333333; 2097152.0; 468361.86666666664; 161.06666666666666; 21.733333333333334; 0.06666666666666667; 0.4 +1378749284; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 441797.6; 0.0; 2.8; 0.0; 0.0 +1378749584; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 248859.73333333334; 31.8; 3.7333333333333334; 0.0; 0.0 +1378749884; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 183149.06666666668; 0.8; 2.533333333333333; 0.0; 0.0 +1378750184; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 188742.4; 0.0; 3.466666666666667; 0.0; 0.4666666666666667 +1378750484; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.0; 0.0; 0.0 +1378750784; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1378751084; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378751384; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378751684; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378751984; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 160779.73333333334; 0.06666666666666667; 7.4; 0.2; 0.13333333333333333 +1378752284; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0; 0.0; 0.0 +1378752585; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1378752885; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378753185; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378753485; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378753785; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 144003.73333333334; 0.0; 13.0; 0.0; 0.4666666666666667 +1378754085; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378754385; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378754685; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378754985; 1; 2599.998989; 0.0; 0.0; 2097152.0; 85282.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378755285; 1; 2599.998989; 0.0; 0.0; 2097152.0; 68504.53333333334; 0.0; 0.8; 0.0; 0.0 +1378755585; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378755885; 1; 2599.998989; 39.86665116466667; 1.5333333333333334; 2097152.0; 293599.2; 161.73333333333332; 14.8; 0.0; 0.2 +1378756185; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 378883.4666666667; 0.0; 1.4; 0.0; 0.0 +1378756485; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 155188.53333333333; 31.8; 3.533333333333333; 0.0; 0.0 +1378756785; 1; 2599.998989; 0.0; 0.0; 2097152.0; 152390.93333333332; 0.0; 1.2; 0.0; 0.0 +1378757085; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378757385; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 156584.8; 0.06666666666666667; 2.6666666666666665; 0.0; 0.4666666666666667 +1378757685; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 139809.06666666668; 0.0; 0.9333333333333333; 0.0; 0.0 +1378757985; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378758285; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378758585; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 1.2666666666666666; 0.0 +1378758885; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 111846.13333333333; 0.13333333333333333; 7.066666666666666; 0.2; 0.13333333333333333 +1378759185; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 111846.4; 0.0; 1.9333333333333333; 0.0; 0.0 +1378759485; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 1.0; 0.06666666666666667; 0.0 +1378759785; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 1.2; 0.0; 0.0 +1378760085; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378760385; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378760685; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 135614.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1378760985; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 139808.0; 0.0; 2.6; 0.06666666666666667; 0.4666666666666667 +1378761285; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 135613.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378761585; 1; 2599.998989; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1378761885; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 1.0; 0.0; 0.0 +1378762185; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378762485; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378762785; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378763086; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1378763386; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378763686; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378763986; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.3333333333333333; 0.0; 0.0 +1378764286; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 1.0; 0.0; 0.0 +1378764586; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 123031.73333333334; 0.06666666666666667; 2.6; 0.0; 0.5333333333333333 +1378764886; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 89476.53333333334; 0.0; 7.066666666666666; 0.2; 0.13333333333333333 +1378765186; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.1333333333333333; 0.0; 0.0 +1378765486; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.0; 0.0; 0.0 +1378765786; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378766086; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 125827.46666666666; 0.06666666666666667; 1.6666666666666667; 0.06666666666666667; 0.13333333333333333 +1378766385; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 116040.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378766685; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132818.66666666666; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378766985; 1; 2599.998989; 0.0; 0.0; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378767285; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378767585; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378767885; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378768185; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 163576.8; 0.06666666666666667; 2.6666666666666665; 0.0; 0.4666666666666667 +1378768486; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 130022.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378768786; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378769086; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378769386; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 85282.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378769686; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 121633.6; 0.0; 0.8; 0.0; 0.0 +1378769986; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 138411.2; 0.0; 0.8; 0.0; 0.0 +1378770286; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 131419.73333333334; 0.0; 1.2; 0.0; 0.0 +1378770586; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378770886; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 111846.66666666667; 0.0; 1.2; 0.0; 0.0 +1378771186; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378771486; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 121633.6; 0.06666666666666667; 7.2; 0.26666666666666666; 0.13333333333333333 +1378771786; 1; 2599.998989; 22.53332457133334; 0.8666666666666667; 2097152.0; 156585.6; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378772086; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 169168.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378772386; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378772686; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 128623.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378772986; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378773286; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 113244.8; 0.5333333333333333; 1.3333333333333333; 0.0; 0.0 +1378773586; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1378773886; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378774186; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 124429.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378774486; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378774786; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 78291.46666666666; 0.0; 1.0; 0.0; 0.0 +1378775086; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1378775386; 1; 2599.998989; 25.999989890000002; 1.0; 2097152.0; 118837.33333333333; 0.0; 2.2; 0.0; 0.5333333333333333 +1378775686; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 146800.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378775986; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378776286; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378776586; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 0.8; 0.0; 0.0 +1378776886; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 141207.46666666667; 0.0; 7.133333333333334; 0.2; 0.13333333333333333 +1378777186; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378777486; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378777787; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378778087; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378778387; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378778687; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378778987; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 121633.06666666667; 0.0; 2.533333333333333; 0.0; 0.4666666666666667 +1378779287; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 135614.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378779587; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378779887; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378780187; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378780487; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378780787; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378781087; 1; 2599.998989; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378781387; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 107652.26666666666; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378781687; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.8; 0.0; 0.0 +1378781987; 1; 2599.998989; 0.0; 0.0; 2097152.0; 107652.26666666666; 0.0; 1.3333333333333333; 0.0; 0.0 +1378782287; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378782587; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 176158.66666666666; 0.06666666666666667; 2.6; 0.0; 0.4666666666666667 +1378782887; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 194334.13333333333; 0.0; 7.0; 0.2; 0.13333333333333333 +1378783187; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 153790.4; 0.0; 1.1333333333333333; 0.0; 0.0 +1378783487; 1; 2599.998989; 0.0; 0.0; 2097152.0; 83884.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378783787; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378784087; 1; 2599.998989; 0.0; 0.0; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378784387; 1; 2599.998989; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378784687; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.53333333334; 0.0; 1.6; 0.0; 0.0 +1378784987; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378785287; 1; 2599.998989; 0.0; 0.0; 2097152.0; 139808.8; 0.0; 0.7333333333333333; 0.06666666666666667; 0.0 +1378785587; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378785887; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378786187; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 145400.26666666666; 0.06666666666666667; 2.3333333333333335; 0.0; 0.4666666666666667 +1378786487; 1; 2599.998989; 0.0; 0.0; 2097152.0; 164973.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378786787; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378787088; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378787388; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378787688; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 0.8; 0.0; 0.0 +1378787988; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378788288; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 102059.73333333334; 0.0; 7.2; 0.2; 0.13333333333333333 +1378788588; 1; 2599.998989; 0.0; 0.0; 2097152.0; 144002.93333333332; 0.0; 1.0; 0.0; 0.0 +1378788888; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.0; 0.0 +1378789188; 1; 2599.998989; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378789488; 1; 2599.998989; 0.0; 0.0; 2097152.0; 86680.26666666666; 0.0; 1.0666666666666667; 0.0; 0.0 +1378789788; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 132817.86666666667; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1378790088; 1; 2599.998989; 0.0; 0.0; 2097152.0; 138411.2; 0.0; 1.0; 0.0; 0.0 +1378790388; 1; 2599.998989; 0.0; 0.0; 2097152.0; 146799.2; 0.0; 0.7333333333333333; 0.0; 0.0 +1378790688; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378790988; 1; 2599.998989; 0.0; 0.0; 2097152.0; 89476.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378791288; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378791588; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 1.2666666666666666; 0.0; 0.0 +1378791888; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 116041.06666666667; 0.0; 1.2666666666666666; 0.0; 0.0 +1378792188; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 127226.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378792488; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 134216.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378792788; 1; 2599.998989; 0.0; 0.0; 2097152.0; 137013.06666666668; 0.0; 1.0; 0.0; 0.0 +1378793088; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 1.2; 0.0; 0.0 +1378793388; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 104856.0; 0.06666666666666667; 2.6666666666666665; 0.0; 0.4666666666666667 +1378793688; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 104856.0; 0.0; 1.0; 0.0; 0.0 +1378793988; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 102059.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378794288; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 127226.13333333333; 0.0; 1.4; 0.0; 0.0 +1378794588; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378794889; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 131420.53333333333; 0.06666666666666667; 8.4; 0.26666666666666666; 0.2 +1378795189; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 123031.73333333334; 0.0; 1.8; 0.0; 0.0 +1378795489; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378795789; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378796089; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 156586.93333333332; 0.0; 1.0; 0.0; 0.0 +1378796389; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116041.06666666667; 0.0; 1.0; 0.0; 0.0 +1378796689; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.7333333333333333; 0.0; 0.0 +1378796989; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 137012.0; 0.06666666666666667; 2.6; 0.0; 0.4666666666666667 +1378797289; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 145400.53333333333; 0.0; 11.866666666666667; 0.0; 0.0 +1378797589; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378797889; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 106254.13333333333; 0.0; 0.6666666666666666; 0.0; 0.0 +1378798189; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1378798489; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378798789; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378799089; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1378799388; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 82485.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378799688; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378799988; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378800289; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 120235.2; 0.0; 0.8; 0.0; 0.0 +1378800589; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 150993.06666666668; 0.06666666666666667; 2.4; 0.0; 0.4666666666666667 +1378800889; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 150993.6; 0.0; 7.266666666666667; 0.2; 0.13333333333333333 +1378801189; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 135614.13333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378801489; 1; 2599.998989; 72.799971692; 2.8; 2097152.0; 661300.2666666667; 161.2; 22.2; 0.06666666666666667; 0.4 +1378801789; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 500518.13333333336; 0.0; 18.933333333333334; 0.0; 0.0 +1378802089; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 237674.66666666666; 31.8; 3.6; 0.0; 0.0 +1378802389; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 148197.6; 5.066666666666666; 2.4; 0.0; 0.0 +1378802689; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 124429.86666666667; 0.0; 1.8; 0.0; 0.0 +1378802989; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378803289; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 82485.86666666667; 0.0; 0.8; 0.0; 0.0 +1378803589; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 79689.6; 0.0; 0.8; 0.0; 0.0 +1378803889; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 67106.4; 0.0; 1.8666666666666667; 0.0; 0.0 +1378804189; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 148196.8; 3.8666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1378804489; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 174761.06666666668; 0.0; 0.7333333333333333; 0.0; 0.0 +1378804789; 1; 2599.998989; 0.0; 0.0; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378805089; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 95069.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378805389; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 69902.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378805689; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1378805989; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378806289; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378806589; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 117439.2; 0.0; 0.8; 0.0; 0.0 +1378806889; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 117439.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378807189; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 149596.26666666666; 0.0; 1.0; 0.0; 0.0 +1378807489; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 164974.13333333333; 12.933333333333334; 13.266666666666667; 0.3333333333333333; 0.2 +1378807789; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 155186.93333333332; 0.0; 2.4; 0.13333333333333333; 0.4666666666666667 +1378808089; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 146799.46666666667; 0.0; 1.3333333333333333; 0.06666666666666667; 0.0 +1378808389; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378808689; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 116041.06666666667; 1.0; 1.6; 0.06666666666666667; 0.0 +1378808990; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 164974.66666666666; 0.0; 1.0; 0.0; 0.0 +1378809290; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 137012.53333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1378809590; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378809890; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 110448.53333333334; 0.0; 1.0666666666666667; 0.0; 0.0 +1378810190; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 137013.06666666668; 0.0; 1.0; 0.0; 0.0 +1378810490; 1; 2599.998989; 0.0; 0.0; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378810790; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 102059.73333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378811090; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 138410.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378811390; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 127226.13333333333; 0.0; 2.4; 0.0; 0.5333333333333333 +1378811690; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 141206.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1378811990; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 110448.53333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378812290; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 124429.86666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378812590; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 85282.13333333333; 0.0; 1.0; 0.06666666666666667; 0.0 +1378812890; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 144003.46666666667; 0.0; 1.0; 0.0; 0.0 +1378813190; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 135614.13333333333; 0.0; 2.3333333333333335; 0.2; 0.13333333333333333 +1378813490; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 164974.4; 0.0; 6.2; 0.0; 0.0 +1378813790; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.0; 0.0 +1378814090; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378814390; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378814690; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 120235.46666666666; 1.4; 1.2666666666666666; 0.0; 0.0 +1378814990; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 160779.46666666667; 0.0; 2.533333333333333; 0.06666666666666667; 0.5333333333333333 +1378815290; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 153789.06666666668; 0.0; 0.9333333333333333; 0.0; 0.0 +1378815590; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378815890; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378816190; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378816490; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1378816790; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378817090; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378817390; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 109050.4; 0.0; 1.0; 0.0; 0.0 +1378817690; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 92272.8; 0.0; 1.0666666666666667; 0.0; 0.0 +1378817990; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378818290; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378818590; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 125828.0; 0.06666666666666667; 2.6; 0.0; 0.4666666666666667 +1378818890; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 134216.0; 0.0; 1.0; 0.0; 0.0 +1378819190; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 1.2; 6.333333333333333; 0.0 +1378819490; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 104856.0; 0.06666666666666667; 7.066666666666666; 0.4; 0.13333333333333333 +1378819791; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 176159.2; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378820091; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 125827.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378820391; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378820691; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 104856.0; 0.0; 1.2; 0.13333333333333333; 0.0 +1378820991; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378821291; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378821591; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 121633.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378821891; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378822191; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 128624.26666666666; 0.0; 2.3333333333333335; 0.0; 0.5333333333333333 +1378822491; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 146799.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378822791; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 155188.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378823091; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 0.8; 0.06666666666666667; 0.0 +1378823391; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 75495.2; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378823691; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 125828.0; 0.0; 1.2; 0.06666666666666667; 0.13333333333333333 +1378823991; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 134216.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378824291; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 83884.0; 0.0; 1.0666666666666667; 0.3333333333333333; 0.0 +1378824591; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378824891; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378825191; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 155188.0; 0.0; 6.866666666666666; 0.26666666666666666; 0.13333333333333333 +1378825491; 1; 2599.998989; 0.0; 0.0; 2097152.0; 150993.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378825791; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 171964.53333333333; 0.0; 2.0; 0.13333333333333333; 0.4666666666666667 +1378826091; 1; 2599.998989; 0.0; 0.0; 2097152.0; 138410.4; 0.06666666666666667; 1.4; 0.0; 0.0 +1378826391; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378826691; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 113244.8; 0.0; 0.8; 0.0; 0.0 +1378826991; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378827291; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 117439.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378827591; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 110448.53333333334; 0.0; 1.2; 0.13333333333333333; 0.0 +1378827891; 1; 2599.998989; 0.0; 0.0; 2097152.0; 114642.93333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1378828191; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 145400.8; 0.0; 1.0; 0.0; 0.0 +1378828491; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 132818.66666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378828791; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131420.53333333333; 0.0; 1.0; 0.2; 0.0 +1378829091; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378829391; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 117439.2; 0.13333333333333333; 2.4; 0.06666666666666667; 0.4666666666666667 +1378829691; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 95069.06666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378829991; 1; 2599.998989; 0.0; 0.0; 2097152.0; 176159.2; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378830291; 1; 2599.998989; 0.0; 0.0; 2097152.0; 150993.33333333334; 0.0; 1.1333333333333333; 0.0; 0.0 +1378830591; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378830892; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378831192; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.13333333333333333; 0.0 +1378831492; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378831791; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 1.0; 0.0; 0.0 +1378832091; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 134216.8; 0.06666666666666667; 7.066666666666666; 0.26666666666666666; 0.13333333333333333 +1378832391; 1; 2599.998989; 0.0; 0.0; 2097152.0; 132817.6; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378832691; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 113244.8; 0.0; 1.0; 0.06666666666666667; 0.0 +1378832991; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 96467.2; 0.0; 2.533333333333333; 0.0; 0.4666666666666667 +1378833291; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378833591; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 123031.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378833891; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378834191; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.26666666666666666; 0.0 +1378834492; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.0; 0.0 +1378834792; 1; 2599.998989; 0.0; 0.0; 2097152.0; 102059.73333333334; 0.0; 1.0; 0.0; 0.0 +1378835092; 1; 2599.998989; 0.0; 0.0; 2097152.0; 97865.33333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378835392; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378835692; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 124429.86666666667; 0.0; 1.2; 0.0; 0.0 +1378835992; 1; 2599.998989; 0.0; 0.0; 2097152.0; 159383.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378836292; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 138411.2; 0.0; 1.6; 0.0; 0.0 +1378836592; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 180352.8; 0.0; 2.066666666666667; 0.0; 0.4666666666666667 +1378836892; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 159383.2; 0.0; 0.9333333333333333; 0.0; 0.0 +1378837192; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 138410.13333333333; 0.0; 1.3333333333333333; 0.0; 0.0 +1378837492; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 104856.0; 0.0; 7.133333333333334; 0.26666666666666666; 0.13333333333333333 +1378837792; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.6; 0.0; 1.0; 0.0; 0.0 +1378838092; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 92272.8; 0.0; 0.8; 0.06666666666666667; 0.0 +1378838392; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 100661.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378838692; 1; 2599.998989; 0.0; 0.0; 2097152.0; 90874.66666666667; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378838992; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378839292; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.4666666666666667; 0.0 +1378839592; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 100661.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378839892; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 90874.66666666667; 0.0; 1.2; 0.06666666666666667; 0.0 +1378840192; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 170566.93333333332; 0.0; 2.466666666666667; 0.0; 0.5333333333333333 +1378840492; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.06666666666666667; 0.0 +1378840792; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 89476.53333333334; 0.0; 0.8; 0.0; 0.0 +1378841092; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 109050.4; 0.0; 11.8; 0.0; 0.0 +1378841392; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 1.2; 0.0; 0.0 +1378841692; 1; 2599.998989; 0.0; 0.0; 2097152.0; 81087.73333333334; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378841992; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 1.0; 0.06666666666666667; 0.0 +1378842293; 1; 2599.998989; 41.599983824; 1.6; 2097152.0; 251656.8; 161.93333333333334; 14.8; 1.4; 0.2 +1378842593; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 418030.4; 0.0; 1.6; 0.0; 0.0 +1378842893; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 198528.53333333333; 31.8; 3.7333333333333334; 0.0; 0.0 +1378843193; 1; 2599.998989; 0.0; 0.0; 2097152.0; 199927.46666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378843493; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 157984.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378843793; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 194334.13333333333; 0.0; 2.4; 0.0; 0.4666666666666667 +1378844093; 1; 2599.998989; 0.0; 0.0; 2097152.0; 171965.33333333334; 0.0; 1.0; 0.0; 0.0 +1378844393; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 127225.6; 0.0; 7.2; 0.4666666666666667; 0.13333333333333333 +1378844693; 1; 2599.998989; 0.0; 0.0; 2097152.0; 121633.33333333333; 0.0; 1.0; 0.0; 0.0 +1378844993; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 142605.06666666668; 0.0; 0.9333333333333333; 0.0; 0.0 +1378845293; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 134216.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378845593; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 132818.66666666666; 0.0; 1.0; 0.06666666666666667; 0.0 +1378845893; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.2; 0.0 +1378846193; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 89476.53333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378846493; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378846793; 1; 2599.998989; 0.0; 0.0; 2097152.0; 113244.8; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378847093; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 93670.93333333333; 0.0; 1.0; 0.0; 0.0 +1378847393; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 130021.6; 0.0; 2.466666666666667; 0.06666666666666667; 0.4666666666666667 +1378847693; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 135614.93333333332; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378847993; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378848293; 1; 2599.998989; 0.0; 0.0; 2097152.0; 99263.46666666666; 0.0; 1.8666666666666667; 0.0; 0.0 +1378848593; 1; 2599.998989; 0.0; 0.0; 2097152.0; 125828.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378848893; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 117438.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378849193; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378849493; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378849793; 1; 2599.998989; 0.0; 0.0; 2097152.0; 139808.53333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378850093; 1; 2599.998989; 0.0; 0.0; 2097152.0; 150993.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378850393; 1; 2599.998989; 0.0; 0.0; 2097152.0; 116040.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378850693; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 82485.86666666667; 0.0; 1.5333333333333334; 0.2; 0.13333333333333333 +1378850993; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 146799.2; 0.0; 8.0; 0.06666666666666667; 0.4666666666666667 +1378851293; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 125828.0; 0.0; 1.0; 0.0; 0.0 +1378851593; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378851893; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 134216.0; 0.0; 1.0; 0.0; 0.0 +1378852193; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 76893.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378852493; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 139808.53333333333; 0.06666666666666667; 1.8; 0.06666666666666667; 0.13333333333333333 +1378852794; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 113244.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378853094; 1; 2599.998989; 22.53332457133334; 0.8666666666666667; 2097152.0; 248860.8; 169.66666666666666; 179.86666666666667; 0.0; 0.0 +1378853394; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 167770.93333333332; 0.0; 1.0; 0.0; 0.0 +1378853694; 1; 2599.998989; 69.33330637333334; 2.666666666666667; 2097152.0; 640328.5333333333; 161.06666666666666; 22.0; 0.0; 0.4 +1378853994; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 408243.73333333334; 0.0; 2.7333333333333334; 0.0; 0.0 +1378854294; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 233480.26666666666; 31.8; 3.6; 0.0; 0.0 +1378854594; 1; 2599.998989; 24.266657230666667; 0.9333333333333332; 2097152.0; 152391.73333333334; 13.333333333333334; 3.7333333333333334; 0.0; 0.4666666666666667 +1378854894; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 145401.06666666668; 0.0; 1.4666666666666666; 0.0; 0.0 +1378855194; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 123031.2; 0.0; 1.0666666666666667; 0.0; 0.0 +1378855494; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 103457.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378855794; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 130022.4; 0.0; 0.8; 0.0; 0.0 +1378856094; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 131419.73333333334; 0.06666666666666667; 1.4; 0.0; 0.0 +1378856394; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 125828.0; 0.0; 1.2; 0.0; 0.0 +1378856694; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 144003.73333333334; 0.0; 7.666666666666667; 0.2; 0.13333333333333333 +1378856994; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 159382.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378857294; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 97865.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378857594; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 97865.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378857894; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378858194; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 157984.0; 0.06666666666666667; 2.466666666666667; 0.0; 0.4666666666666667 +1378858494; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 144002.93333333332; 0.0; 1.0; 0.06666666666666667; 0.0 +1378858794; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378859094; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378859394; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 123031.73333333334; 0.0; 1.0; 0.0; 0.0 +1378859694; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 117439.2; 0.5333333333333333; 1.3333333333333333; 0.0; 0.0 +1378859994; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 90874.66666666667; 0.0; 1.0; 0.0; 0.0 +1378860294; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 93670.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378860594; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 111846.66666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378860894; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 114642.93333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378861194; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378861494; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 141206.93333333332; 0.0; 1.0; 0.0; 0.0 +1378861794; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 183149.86666666667; 0.0; 2.3333333333333335; 0.06666666666666667; 0.4666666666666667 +1378862094; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 152392.53333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378862394; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378862694; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 89476.53333333334; 0.0; 1.0; 0.0; 0.0 +1378862994; 1; 2599.998989; 20.799991912; 0.8; 2097152.0; 124429.86666666667; 0.0; 7.066666666666666; 0.26666666666666666; 0.06666666666666667 +1378863294; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 155188.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378863595; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 132818.66666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378863895; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 117439.2; 0.0; 1.0; 0.0; 0.0 +1378864195; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 88078.4; 0.0; 0.8; 0.0; 0.0 +1378864494; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1378864794; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 128623.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378865094; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 124429.86666666667; 0.0; 1.0; 0.0; 0.0 +1378865394; 1; 2599.998989; 22.53332457133334; 0.8666666666666667; 2097152.0; 114642.93333333333; 0.06666666666666667; 2.533333333333333; 0.06666666666666667; 0.4666666666666667 +1378865694; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 137013.06666666668; 0.0; 0.8666666666666667; 0.0; 0.0 +1378865994; 1; 2599.998989; 19.066659252666668; 0.7333333333333333; 2097152.0; 95069.06666666667; 0.0; 0.8; 0.0; 0.0 +1378866294; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 95069.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378866594; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 103457.86666666667; 0.0; 0.7333333333333333; 0.0; 0.0 +1378866894; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 134216.8; 0.0; 0.6666666666666666; 0.0; 0.0 +1378867194; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378867494; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1378867794; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 120235.46666666666; 0.0; 1.2; 0.0; 0.0 +1378868094; 1; 2599.998989; 15.599993934000002; 0.6; 2097152.0; 102059.73333333334; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1378868394; 1; 2599.998989; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 0.7333333333333333; 1.2666666666666666; 0.0 +1378868694; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 137012.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378868994; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 178955.2; 12.8; 14.2; 0.3333333333333333; 0.7333333333333333 +1378869294; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 201325.06666666668; 0.0; 1.2666666666666666; 0.0; 0.0 +1378869594; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 171964.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378869894; 1; 2599.998989; 0.0; 0.0; 2097152.0; 131420.0; 0.0; 0.8; 0.0; 0.0 +1378870194; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 99263.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378870494; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 1.0; 0.0; 0.0 +1378870794; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378871094; 1; 2599.998989; 0.0; 0.0; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378871394; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 0.7333333333333333; 0.0; 0.0 +1378871695; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378871995; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 88078.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378872295; 1; 2599.998989; 0.0; 0.0; 2097152.0; 96467.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378872595; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 157983.2; 0.0; 2.3333333333333335; 0.0; 0.4666666666666667 +1378872895; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 116041.06666666667; 0.0; 0.8; 0.0; 0.0 +1378873195; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 130022.4; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378873495; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.6666666666666666; 0.06666666666666667; 0.0 +1378873795; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.6666666666666666; 0.0; 0.0 +1378874095; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 107652.26666666666; 0.0; 0.6666666666666666; 0.0; 0.0 +1378874395; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378874695; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378874995; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8; 0.06666666666666667; 0.0 +1378875295; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.6; 0.0; 0.8; 0.0; 0.0 +1378875595; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 142604.8; 0.0; 7.2; 0.26666666666666666; 0.2 +1378875895; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378876195; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 114642.93333333333; 0.06666666666666667; 2.2666666666666666; 0.0; 0.4666666666666667 +1378876495; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 157984.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378876795; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 131420.53333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378877095; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 127226.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378877395; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 127225.33333333333; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378877695; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 124429.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378877995; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 100661.6; 0.0; 1.1333333333333333; 0.0; 0.0 +1378878295; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378878595; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 121633.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378878895; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1378879195; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378879495; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378879795; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 157983.73333333334; 0.06666666666666667; 2.066666666666667; 0.0; 0.4666666666666667 +1378880095; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 139808.53333333333; 0.0; 1.1333333333333333; 0.0; 0.0 +1378880396; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1378880696; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 134216.53333333333; 0.0; 0.9333333333333333; 0.0; 0.0 +1378880996; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 148197.6; 0.0; 6.933333333333334; 0.26666666666666666; 0.2 +1378881296; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 139808.53333333333; 0.0; 2.4; 0.0; 0.06666666666666667 +1378881596; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 110448.53333333334; 0.0; 2.1333333333333333; 0.0; 0.0 +1378881896; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378882196; 1; 2599.998989; 0.0; 0.0; 2097152.0; 118837.33333333333; 0.0; 1.0; 0.0; 0.0 +1378882496; 1; 2599.998989; 0.0; 0.0; 2097152.0; 75495.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378882796; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378883096; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 113244.8; 1.4666666666666666; 1.4; 0.0; 0.0 +1378883396; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 195732.26666666666; 0.0; 2.2666666666666666; 0.0; 0.5333333333333333 +1378883696; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 199926.93333333332; 0.0; 0.9333333333333333; 0.0; 0.0 +1378883996; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 104856.0; 0.0; 0.8666666666666667; 0.06666666666666667; 0.0 +1378884296; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 130022.4; 0.0; 1.1333333333333333; 0.06666666666666667; 0.0 +1378884596; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 109050.4; 0.0; 11.8; 1.7333333333333334; 0.0 +1378884896; 1; 2599.998989; 0.0; 0.0; 2097152.0; 128624.26666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378885196; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.9333333333333333; 0.06666666666666667; 0.0 +1378885496; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 92272.8; 0.0; 1.8; 0.0; 0.0 +1378885796; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 116041.06666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378886096; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 134216.8; 0.0; 0.9333333333333333; 0.0; 0.0 +1378886396; 1; 2599.998989; 0.0; 0.0; 2097152.0; 109050.4; 0.0; 0.9333333333333333; 0.0; 0.0 +1378886696; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 124429.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378886996; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 157983.2; 0.13333333333333333; 9.266666666666667; 0.26666666666666666; 0.6 +1378887296; 1; 2599.998989; 12.133328615333333; 0.4666666666666666; 2097152.0; 178955.73333333334; 0.0; 0.9333333333333333; 0.0; 0.0 +1378887596; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.9333333333333333; 0.0 +1378887896; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 118837.33333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378888196; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378888496; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 106254.13333333333; 0.0; 1.2; 0.0; 0.0 +1378888796; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 113244.8; 0.0; 1.0; 0.0; 0.0 +1378889096; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 142604.0; 0.0; 0.8666666666666667; 0.0; 0.0 +1378889396; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 109049.86666666667; 0.0; 1.0; 0.0; 0.0 +1378889696; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 1.0666666666666667; 0.06666666666666667; 0.0 +1378889997; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.13333333333333333; 0.0 +1378890297; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 137013.06666666668; 0.0; 1.0; 0.0; 0.0 +1378890597; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 156585.33333333334; 0.2; 2.4; 0.0; 0.4666666666666667 +1378890897; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 111846.66666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378891197; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 124429.86666666667; 0.0; 1.1333333333333333; 0.0; 0.0 +1378891497; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 107652.26666666666; 0.0; 0.8666666666666667; 2.0; 0.0 +1378891797; 1; 2599.998989; 0.0; 0.0; 2097152.0; 103457.86666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378892097; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 109050.4; 0.0; 0.8666666666666667; 0.0; 0.0 +1378892397; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378892697; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 92272.8; 0.0; 8.066666666666666; 0.2; 0.13333333333333333 +1378892997; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 130021.6; 0.0; 0.9333333333333333; 0.0; 0.0 +1378893297; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 146799.2; 20.4; 2.1333333333333333; 0.0; 0.06666666666666667 +1378893597; 1; 2599.998989; 22.53332457133334; 0.8666666666666667; 2097152.0; 149596.26666666666; 0.0; 4.066666666666666; 0.0; 0.0 +1378893897; 1; 2599.998989; 13.866661274666667; 0.5333333333333333; 2097152.0; 183149.86666666667; 0.0; 2.8; 0.0; 0.0 +1378894197; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 148197.06666666668; 0.0; 2.066666666666667; 0.0; 0.4666666666666667 +1378894497; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 138411.2; 0.0; 0.8666666666666667; 0.0; 0.0 +1378894797; 1; 2599.998989; 0.0; 0.0; 2097152.0; 111846.66666666667; 0.0; 0.8666666666666667; 0.0; 0.0 +1378895097; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378895397; 1; 2599.998989; 0.0; 0.0; 2097152.0; 106254.13333333333; 0.0; 1.2666666666666666; 0.0; 0.0 +1378895697; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378895997; 1; 2599.998989; 0.0; 0.0; 2097152.0; 123031.73333333334; 0.0; 0.8666666666666667; 0.0; 0.0 +1378896297; 1; 2599.998989; 0.0; 0.0; 2097152.0; 137012.26666666666; 0.0; 0.9333333333333333; 0.0; 0.0 +1378896597; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 100661.6; 0.0; 1.0666666666666667; 0.0; 0.0 +1378896897; 1; 2599.998989; 0.0; 0.0; 2097152.0; 93670.93333333333; 0.0; 0.8; 0.0; 0.0 +1378897197; 1; 2599.998989; 0.0; 0.0; 2097152.0; 110448.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378897497; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 116041.06666666667; 0.0; 0.9333333333333333; 0.0; 0.0 +1378897797; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 166372.26666666666; 0.0; 2.4; 0.0; 0.5333333333333333 +1378898097; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 173362.93333333332; 0.0; 1.2; 0.0; 0.0 +1378898397; 1; 2599.998989; 0.0; 0.0; 2097152.0; 124429.86666666667; 0.0; 0.8; 0.0; 0.0 +1378898697; 1; 2599.998989; 10.399995956; 0.4; 2097152.0; 92272.8; 0.0; 7.2; 0.2; 0.13333333333333333 +1378898997; 1; 2599.998989; 0.0; 0.0; 2097152.0; 120235.46666666666; 0.0; 0.8666666666666667; 0.0; 0.0 +1378899297; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 106254.13333333333; 0.0; 0.8666666666666667; 0.0; 0.0 +1378899597; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 110448.53333333334; 0.0; 1.2666666666666666; 0.0; 0.0 +1378899897; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 160780.0; 0.0; 1.2666666666666666; 0.06666666666666667; 0.0 +1378900197; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 132817.86666666667; 0.0; 1.0666666666666667; 1.4; 0.0 +1378900497; 1; 2599.998989; 0.0; 0.0; 2097152.0; 104856.0; 0.0; 0.7333333333333333; 0.0; 0.0 +1378900797; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 97865.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378901097; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 90874.66666666667; 0.0; 0.8; 0.0; 0.0 +1378901397; 1; 2599.998989; 6.933330637333333; 0.26666666666666666; 2097152.0; 130022.4; 0.06666666666666667; 2.533333333333333; 0.0; 0.5333333333333333 +1378901697; 1; 2599.998989; 0.0; 0.0; 2097152.0; 184547.2; 0.0; 1.0; 0.0; 0.0 +1378901997; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 128624.26666666666; 0.0; 1.1333333333333333; 0.0; 0.0 +1378902297; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 114642.93333333333; 0.0; 1.2; 0.0; 0.0 +1378902598; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 109050.4; 0.0; 0.8; 0.0; 0.0 +1378902898; 1; 2599.998989; 0.0; 0.0; 2097152.0; 79689.6; 0.0; 0.8666666666666667; 0.0; 0.0 +1378903198; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 0.8666666666666667; 0.0; 0.0 +1378903498; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 125828.0; 0.0; 1.0666666666666667; 0.0; 0.0 +1378903798; 1; 2599.998989; 5.199997978; 0.2; 2097152.0; 95069.06666666667; 0.0; 1.0666666666666667; 0.0; 0.0 +1378904098; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.8; 0.06666666666666667; 0.0 +1378904398; 1; 2599.998989; 0.0; 0.0; 2097152.0; 76893.33333333333; 0.0; 1.0666666666666667; 0.0; 0.0 +1378904698; 1; 2599.998989; 1.7333326593333334; 0.06666666666666667; 2097152.0; 104856.0; 0.0; 0.9333333333333333; 0.0; 0.0 +1378904998; 1; 2599.998989; 77.99996967000001; 3.0; 2097152.0; 450186.6666666667; 161.06666666666666; 107.6; 12.933333333333334; 1.2666666666666666 +1378905298; 1; 2599.998989; 17.333326593333336; 0.6666666666666667; 2097152.0; 633338.4; 0.0; 45.13333333333333; 0.2; 0.13333333333333333 +1378905598; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 297792.8; 31.8; 3.466666666666667; 0.0; 0.0 +1378905898; 1; 2599.998989; 8.666663296666668; 0.33333333333333337; 2097152.0; 162177.86666666667; 5.066666666666666; 2.2; 0.0; 0.0 +1378906198; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 142604.8; 0.0; 1.6; 0.0; 0.0 +1378906498; 1; 2599.998989; 3.4666653186666667; 0.13333333333333333; 2097152.0; 125827.2; 0.0; 1.3333333333333333; 0.0; 0.0 +1378906798; 1; 2599.998989; 0.0; 0.0; 2097152.0; 92272.8; 0.0; 1.0; 0.06666666666666667; 0.0 diff --git a/opendc-trace/opendc-trace-api/src/test/resources/bitbrains/vm.txt b/opendc-trace/opendc-trace-api/src/test/resources/bitbrains/vm.txt new file mode 100644 index 00000000..28bebb0c --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/resources/bitbrains/vm.txt @@ -0,0 +1,2 @@ +1631911500 21.2 22.10 0.0 0.0 0.67 1.2 0.0 0.0 5 1 abc 1 0.01 1 10 0.0 0.0 2699 vm 4096 +1631911800 30.4 31.80 0.0 0.0 0.56 1.3 0.0 0.0 5 1 abc 1 0.02 1 10 0.0 0.0 2699 vm 4096 diff --git a/opendc-trace/opendc-trace-api/src/test/resources/gwf/trace.gwf b/opendc-trace/opendc-trace-api/src/test/resources/gwf/trace.gwf new file mode 100644 index 00000000..2f99616d --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/resources/gwf/trace.gwf @@ -0,0 +1,71 @@ +WorkflowID, JobID , SubmitTime, RunTime , NProcs , ReqNProcs , Dependencies +0 , 1 , 16 , 11 , 1 , 1 , +0 , 2 , 40 , 11 , 1 , 1 , 1 +0 , 3 , 40 , 11 , 1 , 1 , 1 +0 , 4 , 64 , 11 , 1 , 1 , 2 +0 , 5 , 63 , 11 , 1 , 1 , 3 +0 , 6 , 64 , 11 , 1 , 1 , 3 +0 , 7 , 87 , 11 , 1 , 1 , 4 5 6 +1 , 8 , 4 , 11 , 1 , 1 , +1 , 9 , 15 , 11 , 1 , 1 , 8 +1 , 10 , 15 , 11 , 1 , 1 , 8 +1 , 11 , 27 , 11 , 1 , 1 , 9 +1 , 12 , 27 , 11 , 1 , 1 , 10 +1 , 13 , 27 , 11 , 1 , 1 , 10 +1 , 14 , 38 , 11 , 1 , 1 , 12 11 13 +2 , 15 , 3 , 11 , 1 , 1 , +2 , 16 , 27 , 11 , 1 , 1 , 15 +2 , 17 , 27 , 11 , 1 , 1 , 15 +2 , 18 , 52 , 11 , 1 , 1 , 16 +2 , 19 , 51 , 11 , 1 , 1 , 17 +2 , 20 , 51 , 11 , 1 , 1 , 17 +2 , 21 , 75 , 11 , 1 , 1 , 20 18 19 +3 , 22 , 3 , 11 , 1 , 1 , +3 , 23 , 27 , 11 , 1 , 1 , 22 +3 , 24 , 27 , 11 , 1 , 1 , 22 +3 , 25 , 51 , 11 , 1 , 1 , 23 +3 , 26 , 50 , 11 , 1 , 1 , 24 +3 , 27 , 51 , 11 , 1 , 1 , 24 +3 , 28 , 75 , 11 , 1 , 1 , 25 27 26 +4 , 29 , 3 , 11 , 1 , 1 , +4 , 30 , 27 , 11 , 1 , 1 , 29 +4 , 31 , 27 , 11 , 1 , 1 , 29 +4 , 32 , 50 , 11 , 1 , 1 , 30 +4 , 33 , 50 , 11 , 1 , 1 , 31 +4 , 34 , 51 , 11 , 1 , 1 , 31 +4 , 35 , 74 , 11 , 1 , 1 , 33 32 34 +5 , 36 , 3 , 11 , 1 , 1 , +5 , 37 , 27 , 11 , 1 , 1 , 36 +5 , 38 , 26 , 11 , 1 , 1 , 36 +5 , 39 , 51 , 11 , 1 , 1 , 37 +5 , 40 , 50 , 11 , 1 , 1 , 38 +5 , 41 , 50 , 11 , 1 , 1 , 38 +5 , 42 , 74 , 11 , 1 , 1 , 39 40 41 +6 , 43 , 4 , 11 , 1 , 1 , +6 , 44 , 27 , 11 , 1 , 1 , 43 +6 , 45 , 27 , 11 , 1 , 1 , 43 +6 , 46 , 51 , 11 , 1 , 1 , 44 +6 , 47 , 51 , 11 , 1 , 1 , 45 +6 , 48 , 51 , 11 , 1 , 1 , 45 +6 , 49 , 75 , 11 , 1 , 1 , 46 47 48 +7 , 50 , 3 , 0 , 1 , 1 , +7 , 51 , 17 , 0 , 1 , 1 , 50 +7 , 52 , 17 , 0 , 1 , 1 , 50 +7 , 53 , 30 , 0 , 1 , 1 , 51 +7 , 54 , 30 , 0 , 1 , 1 , 52 +7 , 55 , 31 , 0 , 1 , 1 , 52 +7 , 56 , 44 , 0 , 1 , 1 , 55 54 53 +8 , 57 , 3 , 11 , 1 , 1 , +8 , 58 , 26 , 11 , 1 , 1 , 57 +8 , 59 , 27 , 11 , 1 , 1 , 57 +8 , 60 , 50 , 11 , 1 , 1 , 58 +8 , 61 , 51 , 11 , 1 , 1 , 59 +8 , 62 , 50 , 11 , 1 , 1 , 59 +8 , 63 , 74 , 11 , 1 , 1 , 62 61 60 +9 , 64 , 3 , 11 , 1 , 1 , +9 , 65 , 27 , 11 , 1 , 1 , 64 +9 , 66 , 27 , 11 , 1 , 1 , 64 +9 , 67 , 51 , 11 , 1 , 1 , 65 +9 , 68 , 50 , 11 , 1 , 1 , 66 +9 , 69 , 51 , 11 , 1 , 1 , 66 +9 , 70 , 74 , 11 , 1 , 1 , 68 69 67 diff --git a/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.0/meta.parquet b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.0/meta.parquet new file mode 100644 index 00000000..d6ff09d8 Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.0/meta.parquet differ diff --git a/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.0/trace.parquet b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.0/trace.parquet new file mode 100644 index 00000000..5b6fa6b7 Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.0/trace.parquet differ diff --git a/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/interference-model.json b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/interference-model.json new file mode 100644 index 00000000..6a0616d9 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/interference-model.json @@ -0,0 +1,20 @@ +[ + { + "vms": [ + "1019", + "1023", + "1052" + ], + "minServerLoad": 0.0, + "performanceScore": 0.8830158730158756 + }, + { + "vms": [ + "1023", + "1052", + "1073" + ], + "minServerLoad": 0.0, + "performanceScore": 0.7133055555552751 + } +] diff --git a/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/meta.parquet b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/meta.parquet new file mode 100644 index 00000000..d8184945 Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/meta.parquet differ diff --git a/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/trace.parquet b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/trace.parquet new file mode 100644 index 00000000..00ab5835 Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/opendc/trace-v2.1/trace.parquet differ diff --git a/opendc-trace/opendc-trace-api/src/test/resources/swf/trace.swf b/opendc-trace/opendc-trace-api/src/test/resources/swf/trace.swf new file mode 100644 index 00000000..c3ecf890 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/resources/swf/trace.swf @@ -0,0 +1,6 @@ +; Excerpt from the PWA: CTC-SP2-1996-3.1-cln.swf + 1 0 588530 937 306 142.00 -1 -1 35100 -1 1 97 -1 307 3 -1 -1 -1 + 2 164472 356587 75 17 2.00 -1 -1 300 -1 1 81 -1 195 3 -1 -1 -1 + 3 197154 459987 35268 306 32792 -1 -1 35100 -1 0 97 -1 307 3 -1 -1 -1 + 4 310448 50431 29493 64 28745 -1 -1 64800 -1 1 38 -1 38 1 -1 -1 -1 + 5 310541 50766 29063 64 28191 -1 -1 64800 -1 1 38 -1 69 1 -1 -1 -1 diff --git a/opendc-trace/opendc-trace-api/src/test/resources/wfformat/trace.json b/opendc-trace/opendc-trace-api/src/test/resources/wfformat/trace.json new file mode 100644 index 00000000..d21f024d --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/resources/wfformat/trace.json @@ -0,0 +1,1342 @@ +{ + "name": "eager-nextflow-chameleon", + "description": "Instance generated with WfCommons - https://wfcommons.org", + "createdAt": "2021-09-06T03:43:31.762479", + "schemaVersion": "1.2", + "author": { + "name": "cc", + "email": "support@wfcommons.org" + }, + "wms": { + "name": "Nextflow", + "version": "21.04.3", + "url": "https://www.nextflow.io" + }, + "workflow": { + "executedAt": "20210906T034331+0000", + "makespan": 275, + "jobs": [ + { + "name": "makebwaindex_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 172.182, + "command": { + "program": "makebwaindex", + "arguments": [ + "bwa", + "index", + "Mammoth_MT_Krause.fasta", + "mkdir", + "BWAIndex", + "&&", + "mv", + "Mammoth_MT_Krause.fasta*", + "BWAIndex" + ] + }, + "parents": [], + "children": [ + "makeseqdict_mammoth_mt_krause.fasta" + ], + "files": [], + "cores": 1.0, + "id": "ID000001", + "category": "makebwaindex", + "avgCPU": 5.8, + "bytesRead": 124, + "bytesWritten": 126, + "memory": 4248 + }, + { + "name": "makeseqdict_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 175.427, + "command": { + "program": "makeseqdict", + "arguments": [ + "picard", + "-Xmx6144M", + "CreateSequenceDictionary", + "R=Mammoth_MT_Krause.fasta", + "O=\"Mammoth_MT_Krause.dict\"" + ] + }, + "parents": [ + "makebwaindex_mammoth_mt_krause.fasta" + ], + "children": [ + "makefastaindex_mammoth_mt_krause.fasta" + ], + "files": [], + "cores": 1.0, + "id": "ID000003", + "category": "makeseqdict", + "avgCPU": 83.5, + "bytesRead": 22728, + "bytesWritten": 1300, + "memory": 104416 + }, + { + "name": "makefastaindex_mammoth_mt_krause.fasta", + "type": "compute", + "runtime": 170.797, + "command": { + "program": "makefastaindex", + "arguments": [ + "samtools", + "faidx", + "Mammoth_MT_Krause.fasta" + ] + }, + "parents": [ + "makeseqdict_mammoth_mt_krause.fasta" + ], + "children": [ + "output_documentation" + ], + "files": [], + "cores": 1.0, + "id": "ID000002", + "category": "makefastaindex", + "avgCPU": 23.8, + "bytesRead": 66, + "bytesWritten": 4, + "memory": 6096 + }, + { + "name": "output_documentation", + "type": "compute", + "runtime": 173.479, + "command": { + "program": "output_documentation", + "arguments": [ + "markdown_to_html.py", + "output.md", + "-o", + "results_description.html" + ] + }, + "parents": [ + "makefastaindex_mammoth_mt_krause.fasta" + ], + "children": [ + "get_software_versions" + ], + "files": [], + "cores": 1.0, + "id": "ID000005", + "category": "output_documentation", + "avgCPU": 84.0, + "bytesRead": 8222, + "bytesWritten": 15165, + "memory": 11488 + }, + { + "name": "get_software_versions", + "type": "compute", + "runtime": 183.445, + "command": { + "program": "get_software_versions", + "arguments": [ + "echo", + "2.3.5", + "&>", + "v_pipeline.txt", + "echo", + "21.04.3", + "&>", + "v_nextflow.txt", + "fastqc", + "--version", + "&>", + "v_fastqc.txt", + "2>&1", + "||", + "true", + "AdapterRemoval", + "--version", + "&>", + "v_adapterremoval.txt", + "2>&1", + "||", + "true", + "fastp", + "--version", + "&>", + "v_fastp.txt", + "2>&1", + "||", + "true", + "bwa", + "&>", + "v_bwa.txt", + "2>&1", + "||", + "true", + "circulargenerator", + "--help", + "|", + "head", + "-n", + "1", + "&>", + "v_circulargenerator.txt", + "2>&1", + "||", + "true", + "samtools", + "--version", + "&>", + "v_samtools.txt", + "2>&1", + "||", + "true", + "dedup", + "-v", + "&>", + "v_dedup.txt", + "2>&1", + "||", + "true", + "##", + "bioconda", + "recipe", + "of", + "picard", + "is", + "incorrectly", + "set", + "up", + "and", + "extra", + "warning", + "made", + "with", + "stderr,", + "this", + "ugly", + "command", + "ensures", + "only", + "version", + "exported", + "(", + "exec", + "7>&1", + "picard", + "MarkDuplicates", + "--version", + "2>&1", + ">&7", + "|", + "grep", + "-v", + "/", + ">&2", + ")", + "2>", + "v_markduplicates.txt", + "||", + "true", + "qualimap", + "--version", + "&>", + "v_qualimap.txt", + "2>&1", + "||", + "true", + "preseq", + "&>", + "v_preseq.txt", + "2>&1", + "||", + "true", + "gatk", + "--version", + "2>&1", + "|", + "head", + "-n", + "1", + ">", + "v_gatk.txt", + "2>&1", + "||", + "true", + "gatk3", + "--version", + "2>&1", + ">", + "v_gatk3.txt", + "2>&1", + "||", + "true", + "freebayes", + "--version", + "&>", + "v_freebayes.txt", + "2>&1", + "||", + "true", + "bedtools", + "--version", + "&>", + "v_bedtools.txt", + "2>&1", + "||", + "true", + "damageprofiler", + "--version", + "&>", + "v_damageprofiler.txt", + "2>&1", + "||", + "true", + "bam", + "--version", + "&>", + "v_bamutil.txt", + "2>&1", + "||", + "true", + "pmdtools", + "--version", + "&>", + "v_pmdtools.txt", + "2>&1", + "||", + "true", + "angsd", + "-h", + "|&", + "head", + "-n", + "1", + "|", + "cut", + "-d", + "-f3-4", + "&>", + "v_angsd.txt", + "2>&1", + "||", + "true", + "multivcfanalyzer", + "--help", + "|", + "head", + "-n", + "1", + "&>", + "v_multivcfanalyzer.txt", + "2>&1", + "||", + "true", + "malt-run", + "--help", + "|&", + "tail", + "-n", + "3", + "|", + "head", + "-n", + "1", + "|", + "cut", + "-f", + "2", + "-d(", + "|", + "cut", + "-f", + "1", + "-d", + ",", + "&>", + "v_malt.txt", + "2>&1", + "||", + "true", + "MaltExtract", + "--help", + "|", + "head", + "-n", + "2", + "|", + "tail", + "-n", + "1", + "&>", + "v_maltextract.txt", + "2>&1", + "||", + "true", + "multiqc", + "--version", + "&>", + "v_multiqc.txt", + "2>&1", + "||", + "true", + "vcf2genome", + "-h", + "|&", + "head", + "-n", + "1", + "&>", + "v_vcf2genome.txt", + "||", + "true", + "mtnucratio", + "--help", + "&>", + "v_mtnucratiocalculator.txt", + "||", + "true", + "sexdeterrmine", + "--version", + "&>", + "v_sexdeterrmine.txt", + "||", + "true", + "kraken2", + "--version", + "|", + "head", + "-n", + "1", + "&>", + "v_kraken.txt", + "||", + "true", + "endorS.py", + "--version", + "&>", + "v_endorSpy.txt", + "||", + "true", + "pileupCaller", + "--version", + "&>", + "v_sequencetools.txt", + "2>&1", + "||", + "true", + "bowtie2", + "--version", + "|", + "grep", + "-a", + "bowtie2-.*", + "-fdebug", + ">", + "v_bowtie2.txt", + "||", + "true", + "eigenstrat_snp_coverage", + "--version", + "|", + "cut", + "-d", + "-f2", + ">v_eigenstrat_snp_coverage.txt", + "||", + "true", + "mapDamage", + "--version", + ">", + "v_mapdamage.txt", + "||", + "true", + "bbduk.sh", + "|", + "grep", + "Last", + "modified", + "|", + "cut", + "-d", + "-f", + "3-99", + ">", + "v_bbduk.txt", + "||", + "true", + "scrape_software_versions.py", + "&>", + "software_versions_mqc.yaml" + ] + }, + "parents": [ + "output_documentation" + ], + "children": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000006", + "category": "get_software_versions", + "avgCPU": 147.8, + "bytesRead": 172760, + "bytesWritten": 1048, + "memory": 387324 + }, + { + "name": "fastqc_jk2782_l1", + "type": "compute", + "runtime": 175.205, + "command": { + "program": "fastqc", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz", + "rename", + "s/_fastqc.zip$/_raw_fastqc.zip/", + "*_fastqc.zip", + "rename", + "s/_fastqc.html$/_raw_fastqc.html/", + "*_fastqc.html" + ] + }, + "parents": [ + "get_software_versions" + ], + "children": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000007", + "category": "fastqc", + "avgCPU": 161.8, + "bytesRead": 35981, + "bytesWritten": 3967, + "memory": 270124 + }, + { + "name": "adapter_removal_jk2782_l1", + "type": "compute", + "runtime": 172.643, + "command": { + "program": "adapter_removal", + "arguments": [ + "mkdir", + "-p", + "output", + "AdapterRemoval", + "--file1", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "--file2", + "JK2782_TGGCCGATCAACGA_L008_R2_001.fastq.gz.tengrand.fq.gz", + "--basename", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe", + "--gzip", + "--threads", + "2", + "--qualitymax", + "41", + "--collapse", + "--trimns", + "--trimqualities", + "--adapter1", + "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", + "--adapter2", + "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA", + "--minlength", + "30", + "--minquality", + "20", + "--minadapteroverlap", + "1", + "cat", + "*.collapsed.gz", + "*.collapsed.truncated.gz", + "*.singleton.truncated.gz", + "*.pair1.truncated.gz", + "*.pair2.truncated.gz", + ">", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz", + "mv", + "*.settings", + "output/", + "##", + "Add", + "R_", + "and", + "L_", + "for", + "unmerged", + "reads", + "for", + "DeDup", + "compatibility", + "AdapterRemovalFixPrefix", + "-Xmx4g", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.tmp.fq.gz", + "|", + "pigz", + "-p", + "1", + ">", + "output/JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz" + ] + }, + "parents": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "children": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000008", + "category": "adapter_removal", + "avgCPU": 160.9, + "bytesRead": 17357, + "bytesWritten": 4405, + "memory": 79308 + }, + { + "name": "fastqc_jk2802_l2", + "type": "compute", + "runtime": 177.338, + "command": { + "program": "fastqc", + "arguments": [ + "fastqc", + "-q", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "rename", + "s/_fastqc.zip$/_raw_fastqc.zip/", + "*_fastqc.zip", + "rename", + "s/_fastqc.html$/_raw_fastqc.html/", + "*_fastqc.html" + ] + }, + "parents": [ + "get_software_versions" + ], + "children": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000009", + "category": "fastqc", + "avgCPU": 120.1, + "bytesRead": 24457, + "bytesWritten": 2181, + "memory": 181060 + }, + { + "name": "adapter_removal_jk2802_l2", + "type": "compute", + "runtime": 174.313, + "command": { + "program": "adapter_removal", + "arguments": [ + "mkdir", + "-p", + "output", + "AdapterRemoval", + "--file1", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq.gz", + "--basename", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se", + "--gzip", + "--threads", + "2", + "--qualitymax", + "41", + "--trimns", + "--trimqualities", + "--adapter1", + "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", + "--adapter2", + "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA", + "--minlength", + "30", + "--minquality", + "20", + "--minadapteroverlap", + "1", + "mv", + "*.settings", + "*.se.truncated.gz", + "output/" + ] + }, + "parents": [ + "fastqc_jk2782_l1", + "fastqc_jk2802_l2" + ], + "children": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "files": [], + "cores": 2.0, + "id": "ID000010", + "category": "adapter_removal", + "avgCPU": 106.5, + "bytesRead": 683, + "bytesWritten": 897, + "memory": 12136 + }, + { + "name": "fastqc_after_clipping_jk2782_l1", + "type": "compute", + "runtime": 15.371, + "command": { + "program": "fastqc_after_clipping", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz" + ] + }, + "parents": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "children": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "files": [], + "cores": 2.0, + "id": "ID000013", + "category": "fastqc_after_clipping", + "avgCPU": 133.3, + "bytesRead": 23788, + "bytesWritten": 1998, + "memory": 215020 + }, + { + "name": "fastqc_after_clipping_jk2802_l2", + "type": "compute", + "runtime": 15.272, + "command": { + "program": "fastqc_after_clipping", + "arguments": [ + "fastqc", + "-t", + "2", + "-q", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz" + ] + }, + "parents": [ + "adapter_removal_jk2782_l1", + "adapter_removal_jk2802_l2" + ], + "children": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "files": [], + "cores": 2.0, + "id": "ID000014", + "category": "fastqc_after_clipping", + "avgCPU": 124.1, + "bytesRead": 23882, + "bytesWritten": 2143, + "memory": 213064 + }, + { + "name": "bwa_jk2802", + "type": "compute", + "runtime": 9.566, + "command": { + "program": "bwa", + "arguments": [ + "bwa", + "aln", + "-t", + "2", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz", + "-n", + "0.04", + "-l", + "1024", + "-k", + "2", + "-o", + "1", + "-f", + "JK2802.sai", + "bwa", + "samse", + "-r", + "\"@RGtID:ILLUMINA-JK2802tSM:JK2802tPL:illuminatPU:ILLUMINA-JK2802-SE\"", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2802.sai", + "JK2802_AGAATAACCTACCA_L008_R1_001.fastq.gz.tengrand.fq_L2.se.truncated.gz", + "|", + "samtools", + "sort", + "-@", + "1", + "-O", + "bam", + "-", + ">", + "\"JK2802\"_\"SE\".mapped.bam", + "samtools", + "index", + "\"JK2802\"_\"SE\".mapped.bam" + ] + }, + "parents": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "children": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000016", + "category": "bwa", + "avgCPU": 15.7, + "bytesRead": 3774, + "bytesWritten": 3367, + "memory": 10628 + }, + { + "name": "bwa_jk2782", + "type": "compute", + "runtime": 9.652, + "command": { + "program": "bwa", + "arguments": [ + "bwa", + "aln", + "-t", + "2", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz", + "-n", + "0.04", + "-l", + "1024", + "-k", + "2", + "-o", + "1", + "-f", + "JK2782.sai", + "bwa", + "samse", + "-r", + "\"@RGtID:ILLUMINA-JK2782tSM:JK2782tPL:illuminatPU:ILLUMINA-JK2782-PE\"", + "BWAIndex/Mammoth_MT_Krause.fasta", + "JK2782.sai", + "JK2782_TGGCCGATCAACGA_L008_R1_001.fastq.gz.tengrand.fq_L1.pe.combined.fq.gz", + "|", + "samtools", + "sort", + "-@", + "1", + "-O", + "bam", + "-", + ">", + "\"JK2782\"_\"PE\".mapped.bam", + "samtools", + "index", + "\"JK2782\"_\"PE\".mapped.bam" + ] + }, + "parents": [ + "fastqc_after_clipping_jk2782_l1", + "fastqc_after_clipping_jk2802_l2" + ], + "children": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000015", + "category": "bwa", + "avgCPU": 69.8, + "bytesRead": 3705, + "bytesWritten": 3355, + "memory": 12876 + }, + { + "name": "samtools_flagstat_jk2782", + "type": "compute", + "runtime": 13.011, + "command": { + "program": "samtools_flagstat", + "arguments": [ + "samtools", + "flagstat", + "JK2782_PE.mapped.bam", + ">", + "JK2782_flagstat.stats" + ] + }, + "parents": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "children": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000026", + "category": "samtools_flagstat", + "avgCPU": 30.1, + "bytesRead": 478, + "bytesWritten": 5, + "memory": 6468 + }, + { + "name": "samtools_flagstat_jk2802", + "type": "compute", + "runtime": 13.129, + "command": { + "program": "samtools_flagstat", + "arguments": [ + "samtools", + "flagstat", + "JK2802_SE.mapped.bam", + ">", + "JK2802_flagstat.stats" + ] + }, + "parents": [ + "bwa_jk2802", + "bwa_jk2782" + ], + "children": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000024", + "category": "samtools_flagstat", + "avgCPU": 118.5, + "bytesRead": 551, + "bytesWritten": 5 + }, + { + "name": "markduplicates_jk2782", + "type": "compute", + "runtime": 22.655, + "command": { + "program": "markduplicates", + "arguments": [ + "mv", + "JK2782_PE.mapped.bam", + "JK2782.bam", + "picard", + "-Xmx4096M", + "MarkDuplicates", + "INPUT=JK2782.bam", + "OUTPUT=JK2782_rmdup.bam", + "REMOVE_DUPLICATES=TRUE", + "AS=TRUE", + "METRICS_FILE=\"JK2782_rmdup.metrics\"", + "VALIDATION_STRINGENCY=SILENT", + "samtools", + "index", + "JK2782_rmdup.bam" + ] + }, + "parents": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "children": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000021", + "category": "markduplicates", + "avgCPU": 173.6, + "bytesRead": 24055, + "bytesWritten": 2319, + "memory": 1400048 + }, + { + "name": "markduplicates_jk2802", + "type": "compute", + "runtime": 21.545, + "command": { + "program": "markduplicates", + "arguments": [ + "mv", + "JK2802_SE.mapped.bam", + "JK2802.bam", + "picard", + "-Xmx4096M", + "MarkDuplicates", + "INPUT=JK2802.bam", + "OUTPUT=JK2802_rmdup.bam", + "REMOVE_DUPLICATES=TRUE", + "AS=TRUE", + "METRICS_FILE=\"JK2802_rmdup.metrics\"", + "VALIDATION_STRINGENCY=SILENT", + "samtools", + "index", + "JK2802_rmdup.bam" + ] + }, + "parents": [ + "samtools_flagstat_jk2782", + "samtools_flagstat_jk2802" + ], + "children": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "files": [], + "cores": 2.0, + "id": "ID000020", + "category": "markduplicates", + "avgCPU": 182.6, + "bytesRead": 24242, + "bytesWritten": 2466, + "memory": 1404624 + }, + { + "name": "preseq_jk2782", + "type": "compute", + "runtime": 12.299, + "command": { + "program": "preseq", + "arguments": [ + "preseq", + "c_curve", + "-s", + "1000", + "-o", + "JK2782_PE.mapped.ccurve", + "-B", + "JK2782_PE.mapped.bam" + ] + }, + "parents": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "children": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000030", + "category": "preseq", + "avgCPU": 81.9, + "bytesRead": 473, + "bytesWritten": 4, + "memory": 12032 + }, + { + "name": "preseq_jk2802", + "type": "compute", + "runtime": 10.188, + "command": { + "program": "preseq", + "arguments": [ + "preseq", + "c_curve", + "-s", + "1000", + "-o", + "JK2802_SE.mapped.ccurve", + "-B", + "JK2802_SE.mapped.bam" + ] + }, + "parents": [ + "markduplicates_jk2782", + "markduplicates_jk2802" + ], + "children": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "files": [], + "cores": 1.0, + "id": "ID000027", + "category": "preseq", + "avgCPU": 77.6, + "bytesRead": 548, + "bytesWritten": 4, + "memory": 11972 + }, + { + "name": "endorspy_jk2782", + "type": "compute", + "runtime": 7.537, + "command": { + "program": "endorspy", + "arguments": [ + "endorS.py", + "-o", + "json", + "-n", + "JK2782", + "JK2782_flagstat.stats" + ] + }, + "parents": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "children": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000031", + "category": "endorspy", + "avgCPU": 44.7, + "bytesRead": 623, + "bytesWritten": 4, + "memory": 12264 + }, + { + "name": "endorspy_jk2802", + "type": "compute", + "runtime": 8.0, + "command": { + "program": "endorspy", + "arguments": [ + "endorS.py", + "-o", + "json", + "-n", + "JK2802", + "JK2802_flagstat.stats" + ] + }, + "parents": [ + "preseq_jk2782", + "preseq_jk2802" + ], + "children": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000032", + "category": "endorspy", + "avgCPU": 54.0, + "bytesRead": 623, + "bytesWritten": 4, + "memory": 12224 + }, + { + "name": "damageprofiler_jk2802", + "type": "compute", + "runtime": 18.596, + "command": { + "program": "damageprofiler", + "arguments": [ + "damageprofiler", + "-Xmx4g", + "-i", + "JK2802_rmdup.bam", + "-r", + "Mammoth_MT_Krause.fasta", + "-l", + "100", + "-t", + "15", + "-o", + ".", + "-yaxis_damageplot", + "0.30" + ] + }, + "parents": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "children": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000033", + "category": "damageprofiler", + "avgCPU": 88.6, + "bytesRead": 25744, + "bytesWritten": 391, + "memory": 242940 + }, + { + "name": "damageprofiler_jk2782", + "type": "compute", + "runtime": 16.736, + "command": { + "program": "damageprofiler", + "arguments": [ + "damageprofiler", + "-Xmx4g", + "-i", + "JK2782_rmdup.bam", + "-r", + "Mammoth_MT_Krause.fasta", + "-l", + "100", + "-t", + "15", + "-o", + ".", + "-yaxis_damageplot", + "0.30" + ] + }, + "parents": [ + "endorspy_jk2782", + "endorspy_jk2802" + ], + "children": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "files": [], + "cores": 1.0, + "id": "ID000036", + "category": "damageprofiler", + "avgCPU": 88.3, + "bytesRead": 25661, + "bytesWritten": 327, + "memory": 198276 + }, + { + "name": "qualimap_jk2802", + "type": "compute", + "runtime": 15.368, + "command": { + "program": "qualimap", + "arguments": [ + "qualimap", + "bamqc", + "-bam", + "JK2802_rmdup.bam", + "-nt", + "2", + "-outdir", + ".", + "-outformat", + "\"HTML\"", + "--java-mem-size=4G" + ] + }, + "parents": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "children": [ + "multiqc_1" + ], + "files": [], + "cores": 2.0, + "id": "ID000053", + "category": "qualimap", + "avgCPU": 177.7, + "bytesRead": 35038, + "bytesWritten": 1712, + "memory": 209440 + }, + { + "name": "qualimap_jk2782", + "type": "compute", + "runtime": 14.223, + "command": { + "program": "qualimap", + "arguments": [ + "qualimap", + "bamqc", + "-bam", + "JK2782_rmdup.bam", + "-nt", + "2", + "-outdir", + ".", + "-outformat", + "\"HTML\"", + "--java-mem-size=4G" + ] + }, + "parents": [ + "damageprofiler_jk2802", + "damageprofiler_jk2782" + ], + "children": [ + "multiqc_1" + ], + "files": [], + "cores": 2.0, + "id": "ID000054", + "category": "qualimap", + "avgCPU": 181.9, + "bytesRead": 34954, + "bytesWritten": 1937, + "memory": 232196 + }, + { + "name": "multiqc_1", + "type": "compute", + "runtime": 46.376, + "command": { + "program": "multiqc", + "arguments": [ + "multiqc", + "-f", + "multiqc_config.yaml", + "." + ] + }, + "parents": [ + "qualimap_jk2802", + "qualimap_jk2782" + ], + "children": [], + "files": [], + "cores": 1.0, + "id": "ID000056", + "category": "multiqc", + "avgCPU": 93.0, + "bytesRead": 1215169, + "bytesWritten": 22599, + "memory": 139496 + } + ] + } +} diff --git a/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/tasks/schema-1.0/part.0.parquet b/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/tasks/schema-1.0/part.0.parquet new file mode 100755 index 00000000..31256990 Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/tasks/schema-1.0/part.0.parquet differ diff --git a/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/workflows/schema-1.0/part.0.parquet b/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/workflows/schema-1.0/part.0.parquet new file mode 100755 index 00000000..872469d5 Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/workflows/schema-1.0/part.0.parquet differ diff --git a/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/workload/schema-1.0/generic_information.json b/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/workload/schema-1.0/generic_information.json new file mode 100755 index 00000000..5949ab59 --- /dev/null +++ b/opendc-trace/opendc-trace-api/src/test/resources/wtf/shell/workload/schema-1.0/generic_information.json @@ -0,0 +1 @@ +{"total_workflows": 3403, "total_tasks": 10208, "domain": "Industrial", "date_start": null, "date_end": null, "num_sites": 3403, "num_resources": 10208.0, "num_users": 1, "num_groups": 1, "total_resource_seconds": 89229.863, "authors": ["Shenjun Ma", "Alexey Ilyushkin", "Alexander Stegehuis", "Alexandru Iosup"], "min_resource_task": 1.0, "max_resource_task": 1.0, "std_resource_task": 0.0, "mean_resource_task": 1.0, "median_resource_task": 1.0, "first_quartile_resource_task": 1.0, "third_quartile_resource_task": 1.0, "cov_resource_task": 0.0, "min_memory": -1, "max_memory": -1, "std_memory": 0.0, "mean_memory": -1.0, "median_memory": -1, "first_quartile_memory": -1, "third_quartile_memory": -1, "cov_memory": -0.0, "min_network_usage": -1, "max_network_usage": -1, "std_network_usage": 0.0, "mean_network_usage": -1.0, "median_network_usage": -1, "first_quartile_network_usage": -1, "third_quartile_network_usage": -1, "cov_network_usage": -0.0, "min_disk_space_usage": -1, "max_disk_space_usage": -1, "std_disk_space_usage": 0.0, "mean_disk_space_usage": -1.0, "median_disk_space_usage": -1, "first_quartile_disk_space_usage": -1, "third_quartile_disk_space_usage": -1, "cov_disk_space_usage": -0.0, "min_energy": -1, "max_energy": -1, "std_energy": 0.0, "mean_energy": -1.0, "median_energy": -1, "first_quartile_energy": -1, "third_quartile_energy": -1, "cov_energy": -0.0, "workload_description": "Chronos is a trace from Shell's Chronos IoT production system. It contains pipelines where sensor data is obtained, checked if values are within range (e.g. temperature, operational status, etc.), and the outcomes are written to persistent storage."} \ No newline at end of file diff --git a/opendc-trace/opendc-trace-api/src/test/resources/wtf/wtf-trace/tasks/schema-1.0/part.0.parquet b/opendc-trace/opendc-trace-api/src/test/resources/wtf/wtf-trace/tasks/schema-1.0/part.0.parquet new file mode 100644 index 00000000..d2044038 Binary files /dev/null and b/opendc-trace/opendc-trace-api/src/test/resources/wtf/wtf-trace/tasks/schema-1.0/part.0.parquet differ -- cgit v1.2.3